• Users Online: 40
  • Home
  • Print this page
  • Email this page


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2018  |  Volume : 7  |  Issue : 1  |  Page : 16-25

Estimation of pyrazinamidase activity using a cell-free In vitro synthesis of pnca and its association with pyrazinamide susceptibility in Mycobacterium tuberculosis


1 Sorbonne Universités, Université Pierre et Marie Curie, UPMC Univ Paris 06, INSERM, U1135, Centre d'Immunologie et des Maladies Infectieuses (CIMI-Paris), team 13, Paris, France; Laboratorio de Bioinformatica y Biología Molecular, Laboratorios de Investigación y Desarrollo, Facultad de Ciencias y Filosofía, Universidad Peruana Cayetano Heredia, Lima, Perú
2 AP-HP, Hôpital Pitié-Salpêtrière, Centre National de Référence des Mycobactéries et de la Résistance des Mycobactéries aux Antituberculeux (NRC MyRMA), Bactériologie-Hygiène, Paris, France
3 Sorbonne Universités, Université Pierre et Marie Curie, UPMC Univ Paris 06, INSERM, U1135, Centre d'Immunologie et des Maladies Infectieuses (CIMI-Paris), team 13, Paris, France
4 Laboratorio de Bioinformatica y Biología Molecular, Laboratorios de Investigación y Desarrollo, Facultad de Ciencias y Filosofía, Universidad Peruana Cayetano Heredia, Lima, Perú
5 Sorbonne Universités, Université Pierre et Marie Curie, UPMC Univ Paris 06, INSERM, U1135, Centre d'Immunologie et des Maladies Infectieuses (CIMI-Paris), team 13; AP-HP, Hôpital Pitié-Salpêtrière, Centre National de Référence des Mycobactéries et de la Résistance des Mycobactéries aux Antituberculeux (NRC MyRMA), Bactériologie-Hygiène, Paris, France

Date of Web Publication7-Mar-2018

Correspondence Address:
Dr Daniel Rueda
Av. Honorio Delgado 430, Urb. Ingeniería, S.M.P., Lima

Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmy.ijmy_187_17

Rights and Permissions
  Abstract 

Background: The main mechanism of resistance to PZA in Mycobacterium tuberculosis relies on mutations on its pyrazinamidase/nicotinamidase. Recently, a rapid colorimetric test relying on the PCR-based in vitro-synthesized-PZase assay has been reported for PZase activity determination from clinical M. tuberculosis isolates but the assay has not been compared with other tests to evaluate PZA susceptibility in M. tuberculosis isolates. Methods: In this study, we have used the PCR-based in vitro-synthesized-PZase assay to analyze the specific pyrazinamidase (PZase) activity of PncA mutants and have correlated the results to the PZA susceptibility phenotype determined by culture in acidic agar medium at pH 6.0. A set of 23 clinical isolates displaying mutated pncA genes (11 PZA-resistant and 12 PZA-susceptible) and 55 PZA-susceptible clinical strains displaying a wild-type pncA gene were tested. Results: Among the 23 mutants tested, 4 corresponded to mutations not reported before (I5T, Y99S, T142R and P77L+V131G). Of the 11 PncA mutants expressed from PZA-resistant clinical isolates, 9 were expressed in vitro at yields > 50% relative to the wild type enzyme. Among them, 6 enzymes (T47P, H51P, H51R, H57D, L85R and T142R) showed no detectable activity, while the relative activities for the 3 others, V9A (27%), G97D (10%) and A146V (28%) were low compared to the wild-type PZase. The remaining two mutants, I5T and V9G, presented very low relative expression (5%) and relative activities values of 12 and 1%, respectively. Twelve mutants were expressed from PZA-susceptible isolates. Their expression was similar to the wild type enzyme and behaved as active pyrazinamidase with specific relative activities ranging from 34 to 314%. Finally, discrepant results were observed for two mutants, V7A and P62T. Conclusion: Thus, this study provides the proof of concept that the PCR-based in vitro-synthesized-PZase assay represents a promising rapid approach for the evaluation of PZA susceptibility based on the estimation of the relative PZase activity from clinical isolates.

Keywords: Cell-free expression, Mycobacterium tuberculosis, PncA, pyrazinamidase, pyrazinamide, resistance, tuberculosis


How to cite this article:
Rueda D, Bernard C, Gandy L, Capton E, Boudjelloul R, Brossier F, Veziris N, Zimic M, Sougakoff W. Estimation of pyrazinamidase activity using a cell-free In vitro synthesis of pnca and its association with pyrazinamide susceptibility in Mycobacterium tuberculosis. Int J Mycobacteriol 2018;7:16-25

How to cite this URL:
Rueda D, Bernard C, Gandy L, Capton E, Boudjelloul R, Brossier F, Veziris N, Zimic M, Sougakoff W. Estimation of pyrazinamidase activity using a cell-free In vitro synthesis of pnca and its association with pyrazinamide susceptibility in Mycobacterium tuberculosis. Int J Mycobacteriol [serial online] 2018 [cited 2018 Aug 17];7:16-25. Available from: http://www.ijmyco.org/text.asp?2018/7/1/16/226781


  Introduction Top


The emergence of multidrug-resistant (MDR) Mycobacterium tuberculosis impacts the control of tuberculosis (TB). In 2014, the World Health Organization estimated that there were 9.6 million cases of TB and that 1.5 million people died from TB worldwide. Among the extant cases of TB, 480,000 were MDR-TB.[1]

Pyrazinamide (PZA) is a first-line anti-TB drug which plays a very important role in shortening the duration of TB treatment.[2],[3] PZA is a prodrug that is converted to its active form, pyrazinoic acid (POA), by a nicotinamidase/pyrazinamidase (PZase) encoded by the pncA gene. PZA has a bactericidal effect on M. tuberculosis, especially under acidic conditions. Three hypotheses have been formulated regarding the mode of action of POA.[4] First, POA would be pumped out of the cell by efflux pumps to be protonated POA (HPOA) in the acidic environment of the bacilli. HPOA could then re-enter the cell and exert its lethal effect by releasing protons inside the cell, acidifying the cytoplasm and disrupting the mycobacterial membrane properties.[4] In a second hypothesis, POA would bind to the 30S ribosomal protein S1 (RpsA), thereby preventing the binding of RpsA to tmRNA and blocking trans-translation.[5] This mechanism would protect against defective mRNA being stalled in a ribosome, otherwise resulting in transcription errors, reading frame alterations or mRNA damage. Finally, PZA could inhibit pantothenate and coenzyme A synthesis by targeting PanD, an aspartate decarboxylase involved in the synthesis of beta-alanine.[6] The main mechanism of resistance to PZA in M. tuberculosis relies on the inactivation of the PZase PncA by mutations in the pncA gene which introduce amino acid substitutions, insertions, or deletions in the protein.[4]

PZA phenotypic determination can be assessed by several approaches based on culture methods including automated culture systems such as Bactec 460, mycobacteria growth indicator tube (MGIT), and BacT/ALERT MB. One important problem with these techniques is the lack of reproducibility of the growth of M. tuberculosis at the acidic pH (5.5) used to test PZA susceptibility on automated systems, leading to difficulties in interpreting phenotypic results. An agar medium with an acidic pH of 6.0 ensuring a better growth of M. tuberculosis comparatively to the poor growth generally observed on the usual media at pH 5.5 has been previously proposed to perform PZA susceptibility testing with M. tuberculosis by an agar proportion method.[7]

The Wayne test[8] is the main biochemical approach to measure the PZase activity of PncA. The test is based on the addition of PZA to a buffer solution containing the PZase, followed by the quantification of POA using ferrous ammonium sulfate which reacts with POA to yield a red compound. Recently, a rapid colorimetric test relying on the polymerase chain reaction (PCR)-based in vitro-synthesized PZase assay has been reported for PZase activity determination from M. tuberculosis clinical isolates.[9] Briefly, the test is based on the amplification from clinical isolates of a long PCR fragment containing the full-length pncA gene, including its putative promoter and additional expression sequences, allowing the synthesis of PZase in a cell-free wheat germ protein expression system. The activity of the in vitro-synthesized PZase is then assessed by a colorimetric method similar to the quantitative Wayne assay.[10] Even though there have been some attempts to use this assay to evaluate PZA susceptibility from M. tuberculosis isolates, the results were not always conclusive.[9],[11]

Molecular methods based on DNA amplification and sequencing techniques can detect all the mutations that can occur in the pncA gene. The approach, which is now widely used in routine laboratories, is affordable and reliable, but the interpretation of the effects of the mutations remains somewhat difficult. There is a large number of studies in the literature reporting the evaluation of the PZase activity of PncA mutants, either directly from M. tuberculosis cultures using the Wayne test, or indirectly from Escherichia coli-expressed recombinant proteins by measuring PZA hydrolysis and correlating the PZase activities to PZA susceptibility of the corresponding M. tuberculosis isolates.[12],[13] However, most of the studies are based on (i) sets of nonisogenic clinical isolates and (ii) various techniques for PZA susceptibility testing, hence there is a lack of concordance when the results from different studies are compared. Notably, several of these reports have described mutations found in susceptible clinical isolates, suggesting that some of the amino acid modifications occurring in PncA could be phenotypically silent mutations which do not impair significantly the PZase activity.[4],[13],[14],[15],[16] Therefore, it is of critical importance not only to detect mutations in PncA, but also to measure directly the PZase activity associated with the detected mutations.

In this report, we have investigated a collection of M. tuberculosis clinical isolates having various mutations in pncA. The phenotype of PZA susceptibility associated with these mutants was determined using a commercial test based on the pH 6.0 agar medium described by Heifets and Sanchez.[7] In parallel, the impact of the corresponding pncA mutations on the PZase activity was assessed by a PCR-based in vitro-synthesized cell-free PZase assay.[9],[11] Using these two approaches, we provide evidence that the PCR-based in vitro-synthesized PZase assay could be used to determine PZA susceptibility from clinical isolates in a relatively short time.


  Materials and Methods Top


Strains and culture conditions

A set of 23 clinical isolates displaying mutated pncA genes, including 11 PZA-resistant and 12 PZA-susceptible strains, were selected among the clinical samples received at the National Reference Center of Tuberculosis of France. Phenotypic resistance to PZA was determined using the acidic agar medium previously described by Heifets and Sanchez, which is made of 7H11 agar base containing 300 μg/ml of PZA, with a pH adjusted to 6.0 by the addition of monosodium phosphate.[7] The corresponding HSTB PZA agar plates were obtained from Biocentric (France). PZA susceptibility was defined by <1% of growth on the PZA-containing medium compared to the PZA-free control plate. In addition to the 23 PncA mutants, 55 PZA-susceptible clinical strains displaying a wild-type (WT) pncA gene were tested.

Cloning, expression, and purification of the PncA control enzymes

Three PncA proteins were cloned, expressed, and purified as His-tag recombinant proteins to be used as reference enzymes in the enzymatic studies: the WT PZase of M. tuberculosis H37Rv (active enzyme), the PZase of Mycobacterium bovis (naturally harboring a H57D substitution, inactive enzyme), and a M. tuberculosis mutant PZase harboring the T87M substitution (active enzyme). The three proteins were produced as previously reported[17] with the following modifications. The H37Rv pncA gene was amplified and introduced in the vector pET29a between the restriction sites Hin dIII and Nde I. The T87M and H57D mutations were introduced in pncA WT using the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The recombinant plasmids were introduced into E. coli TOP10 to be purified and transformed into E. coli BL21 (DE3) (Stratagene). In order to express the proteins, one colony was inoculated in 4 mL of Luria-Bertani (LB) broth and cultured overnight to inoculate a volume of 500 mL of LB medium containing 30 μg/mL of kanamycin that was incubated at 37°C under agitation. When the culture reached an absorbance of 0.6 at 600 nm, isopropyl β-D-thiogalactoside was added at a final concentration of 0.4 mM and the culture was shaken at 18°C overnight (16 h). After centrifugation, the pellet was resuspended in 20 mL of Bis-Tris 20 mM pH 6.0-DTT 1 mM, sonicated, and centrifuged at 4°C during 30 min at 10,000 rpm. The supernatant was recovered and mixed to 1 ml of spermidine at 90 mg/ml before 2 h of centrifugation at 10,000 rpm (4°C). The new supernatant was filtered using a 0.20 μm filter Minisart (Sartorius Stedim biotech) and was loaded onto a 5 mL HiTrap Q HP column equilibrated in a Bis-Tris 20 mM pH 6.0-DTT 1 mM buffer. The protein was eluted on an Akta chromatography system using a linear gradient of NaCl (0-1 M) in buffer Bis-Tris 20 mM pH 6.0-DTT 1 mM. The eluted fractions were monitored using the software Unicorn 5.1 (GE Healthcare, Chicago, Illinois, USA). The purified proteins were analyzed using 14% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels. The PncA-containing fractions were concentrated using Amicon ultra 15-mL concentrators (Millipore). The protein concentration was estimated using the Bradford assay (Biorad).

Enzymatic activity measurement of control enzymes by the colorimetric Wayne assay

The enzymatic activity of the three control enzymes (PncA WT of M. tuberculosis, PncA-H57D of M. bovis, and PncA-T87 of M. tuberculosis) was determined by measuring the reaction of PZA hydrolysis in a colorimetric assay, as previously described.[14] 1.5 μM of PZase was incubated in 0.5 mL of reaction medium containing 2 mM of PZA in a sodium phosphate buffer 50 mM (pH 6.6). At different times of the reaction, 45 μL of the reaction mix was mixed with 10 μL of ferrous ammonium sulfate 20% and then with 1 mL of cold glycine-HCl 100 mM buffer at pH 3.4. The mixture was centrifuged at 4°C, 14,000 rpm during 5 min and its absorbance was measured at 450 nm.

In vitro expression of selected PncA proteins

The in vitro expression of the PncA mutants identified in our collection of M. tuberculosis clinical isolates and of the H37Rv WT PZase was carried out using the approach described by Li et al.[11] The PCR-based in vitro expression system, the RTS™ 100 Wheat Germ CECF kit, was used to express the PncA proteins, with the following modifications. Two sets of primers were used in DNA amplifications: Primers RT-F (5'-CGGACGGATTTGTCGCTCAC-3') and RT-R (5'-GCCCGATGAAGGTGTCGTAGAAG-3') for the Long PCR reaction and primers F-5 (5'-TAATACGACTCACTATAGGATACTCCCC CACAACAGCTTACAATACTCCCCCACA CAGCTTACAAATACTCCCCC AGTC GCCCGAACGTAAGGAGGACGT-3') and R-1 (5'-ACCGCCGCCAACAGTTCATCCCGGT-3') for the second PCR reaction (the 5' UTR sequence which enhances protein expression in the wheat germ system is shown in boldface).

The Long PCR reaction mix (50 μL) consisted of 0.2 μL of Amplitaq Gold DNA Polymerase (Applied Biosystems), 25 μL of water, 5 μL of 10 × PCR Gold buffer, 5 μL of MgCl2, 5 μL of dNTP 10 mM, 5 μL of primer RT-F (4 μM), 5 μL of primer RT-R (4 μM), and 5 μL of DNA template obtained by heat-shock protein from a suspension of M. tuberculosis cells. DNA amplification was performed under the following conditions: denaturation step at 98°C for 120 s, followed by 35 cycles of denaturation (98°C for 10 s), annealing (64°C for 65 s), and extension (72°C for 60 s), with a final elongation step of 10 min at 72°C. The expected size of the DNA amplicons was checked by electrophoresis on 1% agarose gel (918 bp for the Long PCR reaction).

The second PCR reaction solution (50 μL) consisted of 0.2 μL of Amplitaq Gold DNA Polymerase (Applied Biosystems), 25 μL of water, 5 μL of buffer 10 × PCR Gold buffer, 5 μL of MgCl2, 5 μL of dNTP 10 mM, 5 μL of primer F-5 (4 μM), 5 μL of primer R-1 (4 μM), and 5 μL DNA template which corresponded to a 1:10 dilution of the first PCR amplification. This reaction was performed under the following conditions: denaturation step at 98°C for 30 s, followed by 35 cycles of denaturation (98°C for 10 s), annealing (68°C for 60 s), and extension (72°C for 30 s), with a final elongation at 72°C for 10 min. After having checked the sizes of the DNA amplicons (698 bp), the presence of the mutations was verified by sequencing using an ABI 310 sequencer with the BigDye terminator method (Applied Biosystems).

PncA mutants were expressed in vitro using the product of the second PCR reaction. The protocol described by Li et al.[11] was used, following the instructions of the manufacturer of the RTS 100 Wheat Germ CECF Kit (5 PRIME) with the following modifications. For each in vitro expression assay, 6 μg of DNA template was used, and the expression reaction was performed at 24°C during 20 h. Each series of four mutants tested also included the expression of the PZases of M. tuberculosis (WT enzyme) and M. bovis (natural H57D variant) as internal positive and negative controls, respectively.

Pyrazinamidase Western blot assay

The in vitro-expressed PncA proteins were resolved on 14% SDS-PAGE gels and were reveled in a Western blot format using a rabbit sera anti-PncA wt enzyme. To permit comparisons between gels, we adjusted the variability of the total amount of proteins corresponding to the mutated PZAses by including in each gel a sample of H37Rv and M. bovis WT PncA proteins for later normalization and estimation of relative expression yields. The fractions were heated at 95°C for 5 min in sample buffer (0.1% SDS, 0.025% [w/v] bromophenol blue, 1% glycerol, 0.0025 M Tris-glycine-HCl, pH 8.0, and 1% β-mercaptoethanol). Electrophoresis was performed at 180 V. Gels were washed three times in sodium phosphate 0.1 M pH 7.4 during 15 min while polyvinylidene difluoride (PVDF) membranes were incubated in ethanol for 20 min. Proteins were electrically transferred onto a PVDF membrane at 0.25 A for 25 min in a Trans Blot SD Semi-dry Transfer cell (Bio-Rad, Hercules, CA, USA) with filter papers wetted in the buffer solution. After the transfer, membranes were washed three times in sodium phosphate pH 7.4, 0.3% Tween 20. A blocking solution of sodium phosphate pH 7.4, 0.3% Tween-20, 3% BSA was prepared as a diluent for the sera sample. Rabbit sera anti-PncA wt enzymes were provided by Dr. Mirko Zimic as lyophilized powder. The final serum dilutions of 1:375, 1:150, and 1:75 were used. The membranes were incubated at room temperature for 150 min, washed four times with sodium phosphate pH 7.4, 0.3% Tween 20, and incubated for 90 min in a solution containing rabbit IgG horseradish peroxidase-conjugated antibody (RD Systems) diluted at 1:20,000 in sodium phosphate pH 7.4, 0.3% Tween 20. The membranes were washed three times in sodium phosphate pH 7.4, 0.3% Tween 20 and three times in sodium phosphate pH 7.4. Finally, 2 mL of the final mix (containing substrates A and B) of Pierce ECL Plus Western Blotting Substrate (Thermo Scientific) was added to each membrane which was incubated for 5 min. The reacting bands were visualized using the ImageQuant LAS 4000 system (GE Healthcare Life Sciences), and the intensity of the PZAse bands was determined to estimate the relative protein production rates with H37Rv as reference [arbitrarily set to 1, [Table 1].
Table 1: Phenotypic and enzymatic characteristics of PncA mutants from M. tuberculosis clinical strains

Click here to view


Specific relative enzymatic activity

The enzymatic activities of the in vitro-expressed PncA proteins were determined using the conditions of the reaction of PZA hydrolysis described above for the three control enzymes, with the following modifications. For each mutant, 30 μL of in vitro expression reaction was incubated in 0.5 mL of reaction medium containing PZA 2 mM and sodium phosphate buffer 50 mM pH 6.6. The fractions for the colorimetric reaction were taken and processed exactly as described above for the control enzymes.

The relative enzymatic activity for a given mutant was obtained by dividing its enzymatic activity at the beginning of the kinetic reaction in the colorimetric Wayne assay by the WT PZAse activity measured in the same batch with H37Rv. The specific relative PZase activities of the different PncA mutants expressed in the different batches were defined as the relative activities of the mutants divided by their relative rates of production assessed from the Western blot assay.


  Results Top


Phenotypic and enzymatic characterization of PncA control enzymes

Three PncA proteins were used as references in the present study. The reference for a fully active PZase was the WT PncA protein of M. tuberculosis H37Rv. The PZase from M. bovis, which is naturally resistant to PZA, was used as negative control for the PZase activity because this enzyme naturally harbors a H57D substitution that suppresses the catalytic activity (His-57 is one of the three essential His-residues coordinating the metal ion in PncA).[17] Finally, we also included the T87M mutant as reference enzyme which was isolated from a PZA-susceptible strain and was shown on preliminary experiments conducted by our group to retain a PZase activity comparable to that of the WT enzyme. The three control enzymes were cloned in pET29a, and then expressed and purified successfully as soluble His-tag proteins (data not shown). The results of the kinetic measurements of these control proteins by the colorimetric assay are shown in [Figure 1]a, indicating relative activities of 6% and 100% for the purified M. bovis PZase (H57D) and the T87M mutant, respectively.
Figure 1: Time course colorimetric assays of wild-type and mutant PncA proteins. (a) Kinetics of pyrazinamide hydrolysis by the three purified control enzymes (PncA wild-type from Mycobacterium tuberculosis H37Rv and the two mutants from Mycobacterium tuberculosis T87M and Mycobacterium bovis H57D). (b and c) Kinetics of pyrazinamide hydrolysis by in vitro-expressed pyrazinamidase. Each series includes the wild-type PncA protein of Mycobacterium tuberculosis, the variant H57D of Mycobacterium Bovis, and four Mycobacterium tuberculosis PncA mutants

Click here to view


Phenotypic and enzymatic characterization of selected PncA mutants

Fifty-five clinical strains displaying a WT pncA gene were assayed on the agar pH 6.0 medium containing PZA at a concentration of 300 μg/ml. All were found to be phenotypically susceptible to PZA [Table 1], and the WT PncA proteins tested by the PCR-based in vitro-synthesized PZase assay displayed PZase activities comparable to that of the WT PncA control [shown on [Figure 1]b and [Figure 1]c for two in vitro-expressed WT enzymes].

Twenty-three pncA mutants were investigated [Table 1]. It is notable that mutations I5T, Y99S, T142R, and P77L+V131G were not reported before. All the mutants presented higher than 50% of relative expression, except I5T, V9G, and P62T which displayed 5%, 5%, and 10% of relative expression, respectively [Table 1]. Examples of results of the PCR-based in vitro-synthesized PZase assay are shown in [Figure 1]b and c for the control enzymes (M. tuberculosis H37Rv PncA WT, the mutant T87M, and M. bovis H57D) and seven of the PncA mutants (I6L, G97D, R140S, M175V, I5T, T47A, and H51R). The results obtained for the 23 mutants are summarized in [Table 1] which shows the relative enzymatic activities and relative expression levels along with the phenotypic results. Even though each experiment set was evaluated only once, the reliability of the kinetics in different batches is indicated by the reproducibility of the kinetics of PZA hydrolysis by the two reference enzymes PncA WT and PncA H57D that were systematically included in the six sets of independent experiments [Figure 1].

Eleven clinical isolates having mutations in the pncA gene were found to be phenotypically resistant to PZA with a percentage of colonies growing on the PZA-containing medium compared to the control medium without antibiotic varying from 2% to 100% [Table 1]. Analysis of these 11 mutants by the PCR-based in vitro-synthesized cell-free PZase assay indicated that their relative activities were drastically reduced compared to the WT PncA enzyme [from 0% to 28%, [Table 1]. The amount of enzyme produced for each variant was assessed by Western blot analysis [Figure 2] and [Table 1], and the PZase activities were reported as specific relative activities in [Figure 3]. Seven PZases expressed in vitro(G9V, T47P, H51P, H51R, H57D, L85R, and T142R) showed no significant activity. Three PncA mutants, V9A, G97D, and A146V, displayed specific activities of 54%, 3%, and 19%, respectively, when compared to the WT PZase [Figure 4]. Notably, the I5T mutant presented a specific relative activity of 240% [Figure 4], a value due to the very low level of expression (5%) of the mutant protein, which had a weak relative activity (12%) compared to PncA WT [Table 1].
Figure 2: Western blots of several PncA proteins separated by gel electrophoresis. The intensity of the PncA bands was used to assess the relative amount of synthesized protein. PncA: positive control obtained with the purified PncA protein. T: negative control consisting of an in vitro expression sample in which PncA was not produced

Click here to view
Figure 3: Relative pyrazinamidase activity and relative PZAs specific activity. Pyrazinamide-R and pyrazinamide-S mean that the corresponding mutant was identified in an isolate resistant or susceptible to pyrazinamide. The lower part of the figure also shows the relative expression of each mutant compared to the wild-type enzyme

Click here to view
Figure 4: Distribution of mutations in the three-dimensional structure of PncA.[17] The catalytic residue Cys138 and the bound pyrazinamide molecule (pyrazinamide) are represented by magenta sticks. The magenta sphere represents the metal ion linked by coordination bonds to three His residues of PncA. Residues in red show the positions of mutations conferring (a) and not conferring (b) resistance to pyrazinamide. Pictures are prepared with the PyMOL Molecular Graphics System, version 1.8, Schrödinger, LLC (open source foundation)

Click here to view


On the other hand, ten clinical isolates harboring pncA genes with missense mutations were found on phenotypic testing to be susceptible to PZA and to produce active PZases on the in vitro assay [relative activity values ranging from 34% to 314%, [Table 1], with specific relative activities between 35% and 105% [Figure 4]. Three mutants, T87M, D63A, and T167I, presented specific activities similar to the WT enzyme (98%, 83%, and 105%, respectively). Mutants I6L, T47A, Y64D, and M175V showed intermediate specific relative activities (59, 68, 50–62%). Finally, P77L-V131G, Y99S, and R140S presented lower specific relative activities at 35%, 41%, and 40%, respectively [Figure 4].

We observed two discrepant results. The V7A mutant was obtained from a PZA-susceptible isolate but was unexpectedly associated with a reduced specific relative activity of 5% (one can note here that based on the Western blot results, V7A was expressed in vitro with a yield comparable to that of PncA WT). Similarly, P62T, which displayed a very low relative PZase activity value of 4% [Table 1] was isolated from a susceptible clinical isolate. Compared to V7A, P62T was expressed in vitro at a very low yield (10%), explaining the fairly high specific activity worked out for this mutant (40%) [Figure 4].


  Discussion Top


The analytical approach used in this study was based on the in vitro synthesis of PncA in a cell-free wheat germ protein expression system coupled with a rapid colorimetric test allowing evaluation of PZase activities.[8],[9] We first validated this approach using three purified control enzymes, the H37Rv WT enzyme from M. tuberculosis, the naturally inactive variant H57D from M. bovis, and the pncA mutant T87M obtained from a M. tuberculosis PZA-susceptible clinical isolate. When compared to the purified enzymes, the in vitro-synthesized PZases showed a very similar enzymatic behavior. The WT pncA protein and the mutant pncA-T87M synthesized in vitro were active and showed the same level of PZase activity, while H57D was found, as expected, to be nearly devoid of catalytic activity (specific relative activity of 0.29% ± 0.13%). The in vitro-synthesized PZase activity testing of the 23 pncA mutants was then conducted by a series of six enzymes, each batch including four mutants and the two control enzymes PncA WT and H57D in order to take into account the possible variations of the expression yields in the different assays.

Among the 23 tested PncA mutants, 11 consisted of enzymes expressed from clinical isolates classified as PZA resistant by the phenotypic method. Seven of them (V9G, T47P, H51P, H51R, H57D, L85R, and T142R) were characterized by a lack of PZase activity while they displayed in vitro expression levels comparable to those of the control enzymes (apart for V9G which showed a low expression level). Based on the systematic review of mutations in PncA associated with PZA resistance published by Ramirez-Busby and Valafar,[15] the seven amino acid modifications found in the inactive PncA variants can be all considered as very high confident resistance mutations. A search for these mutations in the literature confirmed that they were virtually all reported in PZA-resistant isolates [Table 1]. Analysis of the three-dimensional (3D) structure of the M. tuberculosis PZase[17] indicated that the amino acid residues at positions 9 (Val), 47 (Thr), 51 (His), and 57 (His) are located in the immediate vicinity of the active site [Figure 3]a. Val-9 is found one residue next to the catalytic aspartate at position 8 and likely contributes to the positioning of the Asp-8 side chain in the active site. On the other side, the side chain of Thr-47 also stabilizes Asp-8, while those of His-51 and His-57 both contribute to the coordination of a metal ion (Mn2+, Fe2+, Mg2+, or Zn2+) essential for the binding of PZA [Figure 3]a[17],[18] (Sheen). The two remaining residues, Leu-85 and Thr-142, are more distant to the catalytic center, but one can note that Thr-142 is located on the helix bearing the catalytic Cys-138 holding the PZA molecule, while the side chain of Leu-85 is at only 3.92 Š from the side chain of Val-9 mentioned above [Figure 3]a.

The last four mutants identified in the PZA-R group, I5T, V9A, G97D, and A146V, displayed different levels of relative PZase activity in the in vitro assay [from 10% to 28%, [Table 1]. Two mutations V9A and G97D occur at critical positions localized one residue next to catalytic residues, Asp-8 and Lys-96, respectively. The A146V mutation, which was previously ranked among the very high confidence resistance mutations,[15] is located far from the active site (average distance of 15 Š) but, like T142R, may affect the structural properties of the helix bearing the catalytic Cys-138 [Figure 3]a. The last mutation, I5T, which is also located far from the active site [at 11 Š from Asp-8, [Figure 3]a, occurs in the middle of a β strand contributing to the PncA β sheet [Figure 3]a. It has been previously suggested that this kind of substitution entails significant alteration of the folding and/or stability of the pncA protein,[17] a hypothesis which is here substantiated by the very low expression level observed on Western blot analysis for the I5T mutant [Figure 2]. Due to this low expression level, the specific relative activity of the I5T mutant is unexpectedly high [240%, [Figure 4] despite its low relative activity of 12%. Considering that it was found in a PZA-susceptible strain, it is very likely that the I5T PZase is not stable enough and/or not properly folded to confer PZA resistance in vivo.

It is worth to highlight that the extent of the impairment of PZase activity linked to a mutation at a given position in pncA greatly depends on the nature of the amino acid replacement occurring at this position. In our study, the substitution of Thr-47 by Pro entailed a complete loss of PZase activity and was associated with phenotypic resistance, while its replacement by Ala resulted in an active PncA mutant identified in a PZA-susceptible isolate [Table 1]. Similarly, the two mutants V9A and V9G exhibited distinct enzymatic behaviors, the former being 27 folds more active than the latter. These observations reinforce the importance of determining the PZase activity before proposing a phenotypic interpretation for different mutations occurring at a given position in PncA.

The specific relative PZase activity of the ten remaining mutants estimated by the cell-free in vitro expression PZase assays and the Western blot assays found all mutants to be active PZase. These enzymes displayed different levels of specific relative activity: 35%–41% for P77L-V131G, Y99S, and R140S; 50%–68% for I16L, T47A, Y64D, and M175V; and 83%–105% for D63A, T87M, and T167I. These results agree well with the results of the PZA susceptibility phenotypic assay that classified the corresponding clinical isolates as PZA susceptible. In the literature, several of these amino acid substitutions have been previously associated with PZA-S isolates [Table 1]. For instance, I6L has been reported by Ramirez-Busby and Valafar[15] to be a very high confidence susceptible mutation (in the literature, it was reported in 124 PZA-S strains versus 8 PZA-R only) [Table 1]. The T47A mutation was reported in 68% of the published studies in PZA-S isolates and in 32% in PZA-R isolates [Table 1].[15] Other mutations such as D63A and T87M were not previously linked to PZA-S isolates in the literature, but they are clearly associated with PZA susceptibility and an unaltered PZase activity in our study (specific relative PZase activities of 83% and 98%, respectively) [Table 1]. Regarding R140S, this mutation was previously reported in 21 PZA-resistant strains from Quebec (Canada), but these strains had the same PncA mutation profile consisting of an 8-nucleotide deletion plus the amino acid substitution Arg140-> Ser.[19] It is therefore very likely that resistance to PZA in these isolates stemmed from the deletion in pncA rather than from the R140S substitution that did not impair the PZase activity in our study [Table 1]. Finally, the double mutant P77L+V131G is reported here for the first time, with a resulting specific PZase activity of 35% from a strain susceptible to PZA, contrasting with a previous study reporting a PZA-R mutant with P77L alone.[20] Further investigations are required to clarify the impact of both mutations on PZase activity. At the structural level, the PZA-S-associated mutations are more scattered and more distant from the active site than the PZA-R-associated mutations [Figure 3]b. In particular, eight mutations (D63A, Y64D, P77L, T87M, Y99S, R140S, T167I, and M175V) affect residues located at the surface of the PncA protein, their side chains being oriented toward the solvent [e.g. D63, Y64, Y99, T167, and M175 as shown in [Figure 3]b. These structural features agree well with the phenotypic and the enzymatic results reported here for these mutations (susceptibility to PZA and active PncA proteins). On the other hand, mutations such as I6L and T47A occur at the level of buried residues, but the replacements of Ile-6 by Leu and Thr-47 by Ala can be considered as conservative enough to preserve the PZase activity of the mutants (specific relative PZase activity of 59% and 68%, respectively).

As shown in [Figure 4], two mutants, V7A and P62T, constituted an ambiguous category of mutants yielding discrepant results as they were identified in PZA-S strains but showed very low relative PZase activities (5% and 4%, respectively) [Table 1]. In the 3D structure of pncA, V7A occurs one residue before the catalytic Asp-8 and is considered in the systematic review of Ramirez-Busby and Valafar and the recent publication of Yadon et al. to be a high-confidence resistance mutation associated with high minimum inhibitory concentration (MIC) values.[55],[56] The other mutation, P62T, which affects a proline residue located in the middle of a β strand contributing to the PncA β sheet [Figure 3]a, gives rise to a very low level of expression in vitro(10 folds lower compared to pncA-wt). Like V7A, different amino acid substitutions at the level of residue P62 (P62Q/L/R) have been reported as high-confidence resistance mutations associated with high MIC values.[15],[21] Therefore, the kinetic results and the structural analysis made in our study by the in vitro approach are rather concordant with the previously published phenotypic results (PZA resistance), and it is likely that the phenotypic analysis made in the present study misclassified the two mutants in the PZA-S category. This unexpected result could be either due to unexplained technical difficulties when performing PZA dug susceptibility testing or to the PZA MICs for the two mutants being lower than the PZA concentration of 300 μg/ml used on the pH 6.0 solid medium.


  Conclusion Top


The approach presented here for evaluating PZase activity from clinical isolates using the PCR-based in vitro-synthesized PZase assay can provide results in <3 days. It compares favorably with the results given by a phenotypic method based on the use of an acidic agar medium at pH 6.0 since almost no activity is associated with PZA-R isolates while specific relative activities of 35%–105% are associated with PZA-S isolates. This study establishes the proof of concept that the PCR-based in vitro-synthesized PZase assay represents a promising approach for rapid evaluation of PZA susceptibility directly from tuberculous patients' samples. However, it has to be highlighted here that this approach should be correlated with other standard phenotypic methods such as the MGIT 960 assay and should be further evaluated on large collections of PncA mutants.

Acknowledgments

We thank G. Millot for his technical assistance.

Financial support and sponsorship

This work was supported by the Université Pierre et Marie Curie (UPMC) and by the Institut National de la Santé et de la Recherche Médicale (INSERM) (grant UPMC-INSERM UMRS1135). D.R. was supported by a scholarship of the Franco-Peruvian Doctoral School in Life Sciences.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Zumla A, George A, Sharma V, Herbert RH; Baroness Masham of Ilton, Oxley A, Oliver M. The WHO 2014 global tuberculosis report – Further to go. Lancet Glob Health 2015;3:e10-2.  Back to cited text no. 1
[PUBMED]    
2.
Zhang Y, Mitchison D. The curious characteristics of pyrazinamide: A review. Int J Tuberc Lung Dis 2003;7:6-21.  Back to cited text no. 2
[PUBMED]    
3.
Mitchison DA. The action of antituberculosis drugs in short-course chemotherapy. Tubercle 1985;66:219-25.  Back to cited text no. 3
[PUBMED]    
4.
Miotto P, Cirillo DM, Migliori GB. Drug resistance in Mycobacterium tuberculosis: Molecular mechanisms challenging fluoroquinolones and pyrazinamide effectiveness. Chest 2015;147:1135-43.  Back to cited text no. 4
[PUBMED]    
5.
Shi W, Zhang X, Jiang X, Yuan H, Lee JS, Barry CE 3rd, et al. Pyrazinamide inhibits trans-translation in Mycobacterium tuberculosis. Science 2011;333:1630-2.  Back to cited text no. 5
[PUBMED]    
6.
Shi W, Chen J, Feng J, Cui P, Zhang S, Weng X, et al. Aspartate decarboxylase (PanD) as a new target of pyrazinamide in Mycobacterium tuberculosis. Emerg Microbes Infect 2014;3:e58.  Back to cited text no. 6
[PUBMED]    
7.
Heifets L, Sanchez T. New agar medium for testing susceptibility of Mycobacterium tuberculosis to pyrazinamide. J Clin Microbiol 2000;38:1498-501.  Back to cited text no. 7
[PUBMED]    
8.
Wayne LG. Simple pyrazinamidase and urease tests for routine identification of mycobacteria. Am Rev Respir Dis 1974;109:147-51.  Back to cited text no. 8
[PUBMED]    
9.
Zhou M, Geng X, Chen J, Wang X, Wang D, Deng J, et al. Rapid colorimetric testing for pyrazinamide susceptibility of M. tuberculosis by a PCR-based in-vitro synthesized pyrazinamidase method. PLoS One 2011;6:e27654.  Back to cited text no. 9
[PUBMED]    
10.
Meinzen C, Proaño A, Gilman RH, Caviedes L, Coronel J, Zimic M, et al. A quantitative adaptation of the wayne test for pyrazinamide resistance. Tuberculosis (Edinb) 2016;99:41-6.  Back to cited text no. 10
    
11.
Li H, Chen J, Zhou M, Geng X, Yu J, Wang W, et al. Rapid detection of Mycobacterium tuberculosis and pyrazinamide susceptibility related to pncA mutations in sputum specimens through an integrated gene-to-protein function approach. J Clin Microbiol 2014;52:260-7.  Back to cited text no. 11
[PUBMED]    
12.
Aono A, Chikamatsu K, Yamada H, Kato T, Mitarai S. Association between pncA gene mutations, pyrazinamidase activity, and pyrazinamide susceptibility testing in Mycobacterium tuberculosis. Antimicrob Agents Chemother 2014;58:4928-30.  Back to cited text no. 12
[PUBMED]    
13.
Sheen P, Ferrer P, Gilman RH, López-Llano J, Fuentes P, Valencia E, et al. Effect of pyrazinamidase activity on pyrazinamide resistance in Mycobacterium tuberculosis. Tuberculosis (Edinb) 2009;89:109-13.  Back to cited text no. 13
    
14.
Lemaitre N, Callebaut I, Frenois F, Jarlier V, Sougakoff W. Study of the structure-activity relationships for the pyrazinamidase (PncA) from Mycobacterium tuberculosis. Biochem J 2001;353:453-8.  Back to cited text no. 14
[PUBMED]    
15.
Ramirez-Busby SM, Valafar F. Systematic review of mutations in pyrazinamidase associated with pyrazinamide resistance in Mycobacterium tuberculosis clinical isolates. Antimicrob Agents Chemother 2015;59:5267-77.  Back to cited text no. 15
[PUBMED]    
16.
Whitfield MG, Warren RM, Streicher EM, Sampson SL, Sirgel FA, van Helden PD, et al. Mycobacterium tuberculosis pncA polymorphisms that do not confer pyrazinamide resistance at a breakpoint concentration of 100 micrograms per milliliter in MGIT. J Clin Microbiol 2015;53:3633-5.  Back to cited text no. 16
[PUBMED]    
17.
Petrella S, Gelus-Ziental N, Maudry A, Laurans C, Boudjelloul R, Sougakoff W, et al. Crystal structure of the pyrazinamidase of Mycobacterium tuberculosis: Insights into natural and acquired resistance to pyrazinamide. PLoS One 2011;6:e15785.  Back to cited text no. 17
    
18.
Sheen P, Ferrer P, Gilman RH, Christiansen G, Moreno-Román P, Gutiérrez AH, et al. Role of metal ions on the activity of Mycobacterium tuberculosis pyrazinamidase. Am J Trop Med Hyg 2012;87:153-61.  Back to cited text no. 18
    
19.
Cheng SJ, Thibert L, Sanchez T, Heifets L, Zhang Y. PncA mutations as a major mechanism of pyrazinamide resistance in Mycobacterium tuberculosis: Spread of a monoresistant strain in Quebec, Canada. Antimicrob Agents Chemother 2000;44:528-32.  Back to cited text no. 19
[PUBMED]    
20.
Miotto P, Cabibbe AM, Feuerriegel S, Casali N, Drobniewski F, Rodionova Y, et al. Mycobacterium tuberculosis pyrazinamide resistance determinants: A multicenter study. MBio 2014;5:e01819-14.  Back to cited text no. 20
[PUBMED]    
21.
Yadon AN, Maharaj K, Adamson JH, Lai YP, Sacchettini JC, Ioerger TR, et al. A comprehensive characterization of pncA polymorphisms that confer resistance to pyrazinamide. Nat Commun 2017;8:588.  Back to cited text no. 21
    
22.
Park SK, Lee JY, Chang CL, Lee MK, Son HC, Kim CM, et al. PncA mutations in clinical Mycobacterium tuberculosis isolates from Korea. BMC Infect Dis 2001;1:4.  Back to cited text no. 22
[PUBMED]    
23.
Hou L, Osei-Hyiaman D, Zhang Z, Wang B, Yang A, Kano K, et al. Molecular characterization of pncA gene mutations in Mycobacterium tuberculosis clinical isolates from China. Epidemiol Infect 2000;124:227-32.  Back to cited text no. 23
    
24.
Flandrois JP, Lina G, Dumitrescu O. MUBII-TB-DB: A database of mutations associated with antibiotic resistance in Mycobacterium tuberculosis. BMC Bioinformatics 2014;15:107.  Back to cited text no. 24
[PUBMED]    
25.
Suzuki Y, Suzuki A, Tamaru A, Katsukawa C, Oda H. Rapid detection of pyrazinamide-resistant Mycobacterium tuberculosis by a PCR-based in vitro system. J Clin Microbiol 2002;40:501-7.  Back to cited text no. 25
[PUBMED]    
26.
Yoon JH, Nam JS, Kim KJ, Ro YT. Characterization of pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis isolates from Korea and analysis of the correlation between the mutations and pyrazinamidase activity. World J Microbiol Biotechnol 2014;30:2821-8.  Back to cited text no. 26
[PUBMED]    
27.
Morlock GP, Crawford JT, Butler WR, Brim SE, Sikes D, Mazurek GH, et al. Phenotypic characterization of pncA mutants of Mycobacterium tuberculosis. Antimicrob Agents Chemother 2000;44:2291-5.  Back to cited text no. 27
[PUBMED]    
28.
Zhang H, Bi LJ, Li CY, Sun ZG, Deng JY, Zhang XE, et al. Mutations found in the pncA gene of Mycobacterium tuberculosis in clinical pyrazinamide-resistant isolates from a local region of China. J Int Med Res 2009;37:1430-5.  Back to cited text no. 28
    
29.
Yüksel P, Tansel O. Characterization of pncA mutations of pyrazinamide-resistant Mycobacterium tuberculosis in Turkey. New Microbiol 2009;32:153-8.  Back to cited text no. 29
    
30.
Portugal I, Barreiro L, Moniz-Pereira J, Brum L. PncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis isolates in Portugal. Antimicrob Agents Chemother 2004;48:2736-8.  Back to cited text no. 30
[PUBMED]    
31.
Hirano K, Takahashi M, Kazumi Y, Fukasawa Y, Abe C. Mutation in pncA is a major mechanism of pyrazinamide resistance in Mycobacterium tuberculosis. Tuber Lung Dis 1997;78:117-22.  Back to cited text no. 31
[PUBMED]    
32.
Sandgren A, Strong M, Muthukrishnan P, Weiner BK, Church GM, Murray MB, et al. Tuberculosis drug resistance mutation database. PLoS Med 2009;6:e2.  Back to cited text no. 32
    
33.
Barco P, Cardoso RF, Hirata RD, Leite CQ, Pandolfi JR, Sato DN, et al. PncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis clinical isolates from the southeast region of Brazil. J Antimicrob Chemother 2006;58:930-5.  Back to cited text no. 33
[PUBMED]    
34.
Sheen P, Méndez M, Gilman RH, Peña L, Caviedes L, Zimic MJ, et al. Sputum PCR-single-strand conformational polymorphism test for same-day detection of pyrazinamide resistance in tuberculosis patients. J Clin Microbiol 2009;47:2937-43.  Back to cited text no. 34
    
35.
Somoskovi A, Dormandy J, Parsons LM, Kaswa M, Goh KS, Rastogi N, et al. Sequencing of the pncA gene in members of the Mycobacterium tuberculosis complex has important diagnostic applications: Identification of a species-specific pncA mutation in “Mycobacterium canettii” and the reliable and rapid predictor of pyrazinamide resistance. J Clin Microbiol 2007;45:595-9.  Back to cited text no. 35
[PUBMED]    
36.
Martin A, Cubillos-Ruiz A, Von Groll A, Del Portillo P, Portaels F, Palomino JC, et al. Nitrate reductase assay for the rapid detection of pyrazinamide resistance in Mycobacterium tuberculosis using nicotinamide. J Antimicrob Chemother 2008;61:123-7.  Back to cited text no. 36
    
37.
Tracevska T, Jansone I, Baumanis V, Nodieva A, Marga O, Skenders G, et al. Spectrum of pncA mutations in multidrug-resistant Mycobacterium tuberculosis isolates obtained in Latvia. Antimicrob Agents Chemother 2004;48:3209-10.  Back to cited text no. 37
    
38.
Mestdagh M, Fonteyne PA, Realini L, Rossau R, Jannes G, Mijs W, et al. Relationship between pyrazinamide resistance, loss of pyrazinamidase activity, and mutations in the pncA locus in multidrug-resistant clinical isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother 1999;43:2317-9.  Back to cited text no. 38
[PUBMED]    
39.
Maslov DA, Zaĭchikova MV, Chernousova LN, Shur KV, Bekker OB, Smirnova TG, et al. Resistance to pyrazinamide in russian Mycobacterium tuberculosis isolates: PncA sequencing versus bactec MGIT 960. Tuberculosis (Edinb) 2015;95:608-12.  Back to cited text no. 39
    
40.
Huang TS, Lee SS, Tu HZ, Huang WK, Chen YS, Huang CK, et al. Correlation between pyrazinamide activity and pncA mutations in Mycobacterium tuberculosis isolates in Taiwan. Antimicrob Agents Chemother 2003;47:3672-3.  Back to cited text no. 40
[PUBMED]    
41.
Mphahlele M, Syre H, Valvatne H, Stavrum R, Mannsåker T, Muthivhi T, et al. Pyrazinamide resistance among South African multidrug-resistant Mycobacterium tuberculosis isolates. J Clin Microbiol 2008;46:3459-64.  Back to cited text no. 41
    
42.
Chiu YC, Huang SF, Yu KW, Lee YC, Feng JY, Su WJ, et al. Characteristics of pncA mutations in multidrug-resistant tuberculosis in Taiwan. BMC Infect Dis 2011;11:240.  Back to cited text no. 42
    
43.
Casali N, Nikolayevskyy V, Balabanova Y, Ignatyeva O, Kontsevaya I, Harris SR, et al. Microevolution of extensively drug-resistant tuberculosis in Russia. Genome Res 2012;22:735-45.  Back to cited text no. 43
[PUBMED]    
44.
Juréen P, Werngren J, Toro JC, Hoffner S. Pyrazinamide resistance and pncA gene mutations in Mycobacterium tuberculosis. Antimicrob Agents Chemother 2008;52:1852-4.  Back to cited text no. 44
    
45.
Sreevatsan S, Pan X, Zhang Y, Kreiswirth BN, Musser JM. Mutations associated with pyrazinamide resistance in pncA of Mycobacterium tuberculosis complex organisms. Antimicrob Agents Chemother 1997;41:636-40.  Back to cited text no. 45
[PUBMED]    
46.
Tan Y, Hu Z, Zhang T, Cai X, Kuang H, Liu Y, et al. Role of pncA and rpsA gene sequencing in detection of pyrazinamide resistance in Mycobacterium tuberculosis isolates from Southern China. J Clin Microbiol 2014;52:291-7.  Back to cited text no. 46
[PUBMED]    
47.
Cuevas-Córdoba B, Xochihua-González SO, Cuellar A, Fuentes-Domínguez J, Zenteno-Cuevas R. Characterization of pncA gene mutations in pyrazinamide-resistant Mycobacterium tuberculosis isolates from Mexico. Infect Genet Evol 2013;19:330-4.  Back to cited text no. 47
    
48.
Denkin S, Volokhov D, Chizhikov V, Zhang Y. Microarray-based pncA genotyping of pyrazinamide-resistant strains of Mycobacterium tuberculosis. J Med Microbiol 2005;54:1127-31.  Back to cited text no. 48
[PUBMED]    
49.
McCammon MT, Gillette JS, Thomas DP, Ramaswamy SV, Rosas II, Graviss EA, et al. Detection by denaturing gradient gel electrophoresis of pncA mutations associated with pyrazinamide resistance in Mycobacterium tuberculosis isolates from the United States-Mexico border region. Antimicrob Agents Chemother 2005;49:2210-7.  Back to cited text no. 49
[PUBMED]    
50.
Stoffels K, Mathys V, Fauville-Dufaux M, Wintjens R, Bifani P. Systematic analysis of pyrazinamide-resistant spontaneous mutants and clinical isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother 2012;56:5186-93.  Back to cited text no. 50
[PUBMED]    
51.
Chan RC, Hui M, Chan EW, Au TK, Chin ML, Yip CK, et al. Genetic and phenotypic characterization of drug-resistant Mycobacterium tuberculosis isolates in Hong Kong. J Antimicrob Chemother 2007;59:866-73.  Back to cited text no. 51
[PUBMED]    
52.
Lemaitre N, Sougakoff W, Truffot-Pernot C, Jarlier V. Characterization of new mutations in pyrazinamide-resistant strains of Mycobacterium tuberculosis and identification of conserved regions important for the catalytic activity of the pyrazinamidase pncA. Antimicrob Agents Chemother 1999;43:1761-3.  Back to cited text no. 52
[PUBMED]    
53.
Wade MM, Volokhov D, Peredelchuk M, Chizhikov V, Zhang Y. Accurate mapping of mutations of pyrazinamide-resistant Mycobacterium tuberculosis strains with a scanning-frame oligonucleotide microarray. Diagn Microbiol Infect Dis 2004;49:89-97.  Back to cited text no. 53
[PUBMED]    
54.
Sekiguchi J, Nakamura T, Miyoshi-Akiyama T, Kirikae F, Kobayashi I, Augustynowicz-Kopec E, et al. Development and evaluation of a line probe assay for rapid identification of pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis strains. J Clin Microbiol 2007;45:2802-7.  Back to cited text no. 54
[PUBMED]    
55.
Bhuju S, Fonseca Lde S, Marsico AG, de Oliveira Vieira GB, Sobral LF, Stehr M, et al. Mycobacterium tuberculosis isolates from Rio de Janeiro reveal unusually low correlation between pyrazinamide resistance and mutations in the pncA gene. Infect Genet Evol 2013;19:1-6.  Back to cited text no. 55
[PUBMED]    
56.
Napiórkowska A, Rüsch-Gerdes S, Hillemann D, Richter E, Augustynowicz-Kopeć E. Characterisation of pyrazinamide-resistant Mycobacterium tuberculosis strains isolated in Poland and Germany. Int J Tuberc Lung Dis 2014;18:454-60.  Back to cited text no. 56
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed462    
    Printed36    
    Emailed0    
    PDF Downloaded134    
    Comments [Add]    

Recommend this journal