• Users Online: 861
  • Home
  • Print this page
  • Email this page


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2018  |  Volume : 7  |  Issue : 1  |  Page : 53-60

Utilization of molecular and conventional methods for the identification of nontuberculous mycobacteria isolated from different water sources


1 Laboratory of Mycobacteria, Faculty of Veterinary Sciences, National University of La Pampa, General Pico, La Pampa, Argentina
2 Biotechnology Institute, National Institute of Agricultural Technology (INTA), Hurlingham, Buenos Aires, Argentina

Date of Web Publication7-Mar-2018

Correspondence Address:
prof Claudia Andrea Tortone
Calle 5 Y 116. Facultad De Ciencias Veterinarias, 6360 General Pico, La Pampa
Argentina
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmy.ijmy_192_17

Rights and Permissions
  Abstract 


Background: The environment is the nontuberculous mycobacteria (NTM) reservoir, opportunistic pathogens of great diversity and ubiquity, which is observed in the constant description of new species capable of causing infection. Since its introduction, molecular methods are essential for species identification. Most comparative studies between molecular and conventional methods, have used isolated strains from clinical samples. Methods: The aim of this study was to evaluate the usefulness of molecular methods, especially the hsp65-PRA (PCR-Restriction Enzyme Analysis), and biochemical tests in the identification of NTM recovered from water of different origins, using the sequencing of 16S rRNA and hsp 65 genes as assessment methods of the previous ones. Species identification was performed for all 56 NTM isolates what were recovered from 32 (42.1%) positive water samples, using conventional phenotypic methods, hsp65-PRA, partial sequencing of 16S rRNA and sequencing of hsp 65 genes. Results: Phenotypic evaluation and hsp65-PRA were concordant with 23 (41.1%) isolates. Also, the PRA was concordant with 16 (28.6%) and 27 (48.2%) isolates, with the partial sequencing of 16S rRNA and sequencing of hsp 65 genes, respectively. It is considered that the 19.6% (n = 11) could not be identified. Conclusion: Identification of NTM environmental isolates to the species level, especially when they are pigmented and fast-growing, both the analysis of the restriction patterns obtained by PRA and the sequencing of the 16S rRNA and hsp 65 genes are insufficient by themselves. Although they are demanding and time-consuming, biochemical tests are very useful to support data obtained by molecular methods.

Keywords: 16S rRNA sequencing, hsp65 sequencing, nontuberculous mycobacteria, restriction enzyme analysis-hsp65, phenotypic methods


How to cite this article:
Tortone CA, Zumárraga MJ, Gioffr AK, Oriani DS. Utilization of molecular and conventional methods for the identification of nontuberculous mycobacteria isolated from different water sources. Int J Mycobacteriol 2018;7:53-60

How to cite this URL:
Tortone CA, Zumárraga MJ, Gioffr AK, Oriani DS. Utilization of molecular and conventional methods for the identification of nontuberculous mycobacteria isolated from different water sources. Int J Mycobacteriol [serial online] 2018 [cited 2019 Sep 19];7:53-60. Available from: http://www.ijmyco.org/text.asp?2018/7/1/53/226783




  Introduction Top


The infections caused by Mycobacterium species called environmental mycobacteria or nontuberculous mycobacteria (NTM) are considered to be emerging diseases worldwide.[1],[2] In Argentina, although precise information is limited, infections are described in both immunocompromised and immunocompetent patients,[3],[4] with pulmonary and extrapulmonary cases.[5] They also affect different species of farm and wild animals.[1]

NTM are characterized by being part of the environmental microflora, not being transmitted from person to person, and being resistant to common disinfectants, such as those used to make water drinkable.[1] Some NTM are of global distribution and other species possess geographically delimited habitats, depending on their ability to survive in different environmental conditions.[6] In our country, there are few studies about possible Mycobacteria species identified in the environment.[7] The ability of these microorganisms to form biofilm and to grow under oligotrophic conditions could explain their adaptation to new ecosystems closely related to humans, such as drinking water distribution systems.[1] Mycobacteria may aerosolize more readily than other bacteria as they have highly hydrophobic cell walls and inhalation of aerosols appears to be its primary transmission route. This usually occurs in artificial water environments, in which aerosolization increases the concentration of NTM in the air.[8]

There is currently a tendency to replace the biochemical typing of NTM by new faster and less complex molecular techniques,[9] of which several comparative studies are known,[10],[11],[12] made mainly with mycobacteria recovered from clinical samples. The sequencing of the 16S rRNA gene is universally considered to be the method of first choice and the sequencing of the hsp 65 gene as the second best alternative,[13] although these are limited to specialized laboratories. Another molecular method is the polymerase chain reaction (PCR)-restriction enzyme analysis (PRA) that can be implemented in low-complexity laboratories.[14] Strains of the same species of NTM may have variants in restriction patterns or sequences not previously described.[15] In addition, the intra-species genetic variability is manifested in their virulence factors, the morphological variation of the colonies, and also whether it is recovered from the environment or from a host.[1] It is not less important that after the introduction of molecular methods, the number of NTM has been expanded and still some remain unclassified.[16] In this study, we expect to compare the phenotypic and molecular methods to be able to establish a work protocol that is more convenient for the identification of the different NTM species in our laboratory. We have identified NTM isolated from tap water, public fountains in General Pico (La Pampa, Argentina), and wetlands in its influence zone, by phenotypic testing and PRA, using the sequencing of the 16S rRNA and hsp 65 genes as methods of assessment of the previous ones.


  Methods Top


Sampling and decontamination of water samples

A total of 76 water samples were collected from General Pico city (65,438 inhabitants, 2012), from three different types of sources, namely, 32 from drinking water distribution systems, 32 from wetlands, and 12 from public fountains, from different sites representing each source. According to the standard methods, 500 ml of each sample was collected in sterile bottles; Na2S2O3 was added to the tap water at a final concentration of 18 mg/l to neutralize up to 5 mg/l of residual chlorine.

Different decontamination methods were used considering the origin of the water sample, for samples of wetlands with high microorganism load, the method described in Fujimora Leite et al.,[17] and for the tap water and water from public fountains processing, the one of Engel.[18] It was inoculated in duplicate onto Löwenstein–Jensen, Stonebrink, and Herrold with mycobactin media,[19] and they were incubated at 25°C, 32°C, 37°C, and 42°C for 3 months.

Phenotypic characterization

The following phenotypic tests were performed on all acid-fast colonies according to the methodology described:[19] evaluation of pigment production and determination of development temperatures; growth in the presence of hydroxylamine; 5% NaCl; semi-quantitative catalase; catalase at 68°C, reduction of nitrates; urease; pyrazinamidase (at 4 days); arylsulfatase (3 days and 2 weeks); β-galactosidase, hydrolysis of Tween 80 (at 5 days and 10 days), iron uptake, tellurite reduction (in 7 days and 9 days), use of mannitol and citrate.

Polymerase chain reaction-restriction enzyme analysis

The methodology described by Telenti et al.[20] was used. One loopful of bacterial growth was suspended in 200 μl of sterile apyrogenic water contained in a capped tube of 1.5 ml and then incubated at 95°C in thermoblock (with agitation) for 40 min. It was then centrifuged 5 min at 12,000 rpm. Five microliters of the bacterial lysate obtained was added to each reaction tube. The mixture for hsp 65 amplification consisted of buffer (10 mM Tris-HCl, pH 9.0, 50 mM KCl, and 0.1% Triton X-100), 1.5 mM MgCl2, 0.2 mM of each dNTP, 25 pmols of each primer, Tb11 (5'-ACCAACGATGGTGTGTCCAT) and Tb12 (5'-CTTGTCGAACCGCATACCCT), 5 μl annealing, and 1.25 U Taq Polymerase (Go Taq®, Promega Corp., USA) in a final volume of 50 μl. The reaction was subjected to an initial denaturation of 96°C for 3 min, followed by 45 cycles of amplification (1 min at 96°C, 1 min at 60°C, and 1 min at 72°C) and 7 min extension at 72°C. A PTC-100 thermocycler (MJ Research, Inc USA) was used. Subsequently, 10 μl of the PCR product was digested with each of the restriction enzymes BstE II and Hae III separately, in a reaction volume of 20 μl. Digestion with the BstE II enzyme was performed at 60°C while with Hae III at 37°C for 12 h. Separation of the resulting fragments from the enzymatic restriction was done in 4% agarose (Agarose 1000, Invitrogen Life Technologies) in 1X Buffer TAE, with ethidium bromide (0.5 μl/ml). Electrophoresis was performed at 100 volts for 4 h. As a molecular weight marker, Cincuenta Marker (Biodynamics, Argentina) was used. Visualization and photographic record were performed by exposing the gel in a UV-light transilluminator (Gel Doc, Bio-Rad). The size of the restriction fragments was determined using the BioNumerics program (Applied Maths, Belgium). Using the algorithm (http://app.chuv.ch/prasite/index.html),[20],[21] we determined the mycobacterial species corresponding to the restriction patterns.

Sequencing of the hsp 65 and 16S rRNA genes

Sequencing of hsp 65 gene was performed using the same oligonucleotides described for PRA[20] (Tb11 and Tb12). For the sequencing of the 16S rRNA gene, a 1037 bp fragment was amplified using oligonucleotides 285 (5'GAGAGTTTGATCCTGGCTCAG3') and 264 (5'TGCACACAGGCCACAAGGGA3').[22] The reaction mixture was identical to that described for PRA and the amplification was performed on a PTC-100 thermocycler (MJ Research, Inc USA) with the following program: initial denaturation at 96°C for 3 min followed by 35 cycles of amplification (1 min at 96°C, 1 min at 55°C, and 2 min at 72°C) and 10 min extension at 72°C. For the sequencing, oligonucleotides 271 (5'CTTAACACATGCAAGTCGAAC3') and 259 (5'TTTCACGAACAACGCGACAA3')[22] were used. The obtained PCR products were purified using the “Illustra GFX PCR DNA and Gel Band Purification Kit, GE Healthcare, UK” kit, according to the manufacturer's specifications. The purified PCR products were quantified in a spectrophotometer at a wavelength of 260 nm (NanoDrop 2000, Thermo Scientific, USA). Sequencing was performed on a 16 capillary ABI3130xl sequencer (Applied Biosystems), using “Big Dye Terminator v3.1” (Cycle Sequencing Kit). The sequences obtained were compared with those deposited in the basic local alignment search tool database (http://blast. ncbi.nlm.nih.gov/Blast.cgi).

Statistical analysis used

Taking into account the partial sequencing of the 16S rRNA gene as a reference method, the data obtained with the other typing methods were classified as identified and unidentified. From there, Cohen's Kappa coefficient (k) was proposed as a measure of agreement. To measure the random error between two methods, we used the correlation coefficient (ρ). Systematic error was analyzed through marginal proportions. These proportions were compared by the McNemar test.


  Results Top


A total of 56 NTM isolates were recovered from 32 (42.1%) positive water samples; 34 isolates corresponded to samples from wetlands (n = 17, 53.1% positive samples), 11 from public fountains (n = 4, 33.3% positive samples), and 11 from drinking water distribution systems (n = 11, 34.4% positive samples). All the isolates were studied using biochemical tests.[18],[23] Initially, slow-growing isolates (n = 13, 33.9%) and/or nonpigmented (n = 16, 28.6%) were identified but not most fast-growing and pigmented colonies (n = 30, 53.6%). Further, the data obtained by conventional methods for 26.8% (n = 15) of the strains did not coincide with any species proposed by the molecular techniques performed. The identification of the isolates by PRA began with the analysis of the restriction patterns, followed by the comparison of results obtained by biochemical and phenotype analysis. The independent use of each method did not allow for the accurate identification of species. The same species with both methods was identified in 41.1% (n = 23) of the strains recovered from the environmental samples. The Kappa coefficient (k) obtained indicates a weak degree of agreement between both methods (k = 0.374). The correlation coefficient (ρ) was 0.448. The difference is significant according to McNemar test (P< 0.001). The biochemical tests showed a higher frequency of strains identified with respect to PRA. The results obtained from the partial sequencing of the 16S rRNA gene are shown in [Table 1]. 58.93% (n = 33) of the NTM had a sequence homology range of 99%–100%, which were identified at species level since they corresponded with some of the other methods used. In the case of strains 76, 78E, 87B, and 88B, although they had a lower percentage of identity (between 97 at <99%), they could be identified with the use of two or more methods. However, isolates 5, 77B, 77C, 78A, 80A, 80C, 89B, and 89C, with homology between 99% and 100%, did not show any coincidence with the other methods used.
Table 1: Identification nontuberculous mycobacteria isolated from tap water, wetlands and public fountains by polymerase chain reaction-restriction enzyme analysis, 16S rRNA sequencing, hsp65 sequencing and biochemical test

Click here to view


The percentages of identity of hsp 65 gene sequences were lower than those obtained by 16S rRNA gene sequencing [Table 1]; a considerable number of isolates (n = 25) showed ≤97% homology although this did not mean any identification at the species level. In the particular case of Mycobacterium vaccae strains, values as low as 93%–94% of similarity were found.

Compared with the other molecular methods, PRA shows a higher percentage of results consistent with the hsp 65 gene sequencing (48.2%) [Table 2]. A value of 0.307 was obtained for Cohen's Kappa coefficient indicating low agreement between these two methods and value of ρ = 0.343 was obtained. The McNemar test showed that this result was significantly different (P< 0.01). The hsp 65-sequencing method had a higher frequency of identified strains. When analyzing the data obtained by biochemical tests with the molecular data, there is a greater coincidence with the sequencing methods than with the PRA. When the concordance between the phenotypic methods and the sequencing of the hsp 65 gene was evaluated, a value of 0.475 was obtained for Cohen's Kappa coefficient, indicating a moderate agreement among them. In this case, the correlation coefficient was ρ = 0.484. The McNemar test showed that the results of conventional methods were not significantly different from the results obtained by hsp 65 sequencing (P = 0.267) with 95% confidence.
Table 2: Summary of concordance among species identification results obtained by sequencing methods, polymerase chain reaction-restriction enzyme analysis-hsp65 and phenotypic tests

Click here to view


The use of different molecular techniques for NTM typing would show the possible presence of nondescribed restriction patterns in the prasite that would belong to new allelic variants within the hsp 65 gene (data not shown).

Biodiversity found in tap water, wetlands, and public fountains is shown in [Figure 1], [Figure 2], [Figure 3]. It is considered that 19.6% of isolated strains could not be identified since there was no concordance between any of the methods used. At the same time, 46.9% (n = 15) of the pigmented and fast-growing strains studied did not present definite results in their identification by the methods used.
Figure 1: Species distribution of mycobacteria isolates in tap water samples based on16S rRNA sequencing and/or hsp65-sequencing

Click here to view
Figure 2: Species distribution of mycobacteria isolated in wetlands waters based on 16S rRNA sequencing and/or hsp65-sequencing

Click here to view
Figure 3: Species distribution of mycobacteria isolated in water of public fountains based on 16S rRNA sequencing and/or hsp65-sequencing

Click here to view



  Discussion Top


The differentiation of the species of the genus Mycobacterium has conventionally been done through the use of biochemical test profiles, being a very laborious methodology that requires a considerable time to be able to emit a result.[21] According to the included studies in the distribution of NTM species from environmental and clinical samples in the Middle East over the last 30 years, identification of NTM by conventional techniques was the most frequently used method.[2] As described by other authors,[21],[23] standard biochemical identification schemes can provide both ambiguous and erroneous results as some of the tests used are not highly reproducible. On the other hand, the phenotype of a species may exhibit remarkable variability depending on the origin of the sample either clinical and/or environmental.[1] It should also be considered that the available documented data of the phenotypic characteristics are limited to the common species, whereas in other less frequent species, all the determinations are not standardized, making the precise identification through this method not possible due to the increasing number of Mycobacterium species with overlapping phenotypic characteristics.[21],[24] We observed some intrinsic variables of the culture that may influence the results of biochemical typing such as inoculum size, incubation time, temperature, and composition of the medium of culture. The biochemical tests must be carried out meticulously and strictly according to the described methodology.

Considering the known difficulties of conventional techniques and the increased incidence of mycobacteriosis over the last decades, nucleic acid sequence identification procedures and commercially available systems have been developed, such as AccuProbe System (Gen-Probe, San Diego, CA) and INNO LiPA Mycobacteria v2 (Fujirebio Europe, Ghent, Belgium). These are relevant methods for laboratory diagnosis, with the disadvantage of characterizing a limited number of species, some probes being nonspecific, several cross-reactions being observed.[25] Other commercial DNA kits were not valid options to solve the problem of specimens that elude NTM species identification in Argentina.[26] The PRA is a rapid method that constitutes a valuable diagnostic tool considered as a test of orientation and support to the identification in the laboratory of mycobacteria.[27] However, its sensitivity and specificity are influenced by a large number of variables or critical points, such as the quality of the agarose for gel production, conditions of electrophoresis, estimation of molecular weights of restriction fragments, and interpretation of patterns.[28] When comparing the results obtained by the PRA method and the biochemical tests, we determined a concordance of 41.1%, while other studies showed a concordance of 74%,[10] 82%,[11] and 95.3%,[27] all cases dealing with strains isolated from clinical samples. On the other hand, the PRA showed higher concordant results with the sequencing of the hsp 65 gene (48.2%) than with the partial sequencing of 16S rRNA (28.6%). This is reasonable since PRA and hsp 65-sequencing are based on the same gene. Different authors obtained better results with the PRA method since they correctly identified 90.3%[10] and 96%[11] of the clinical isolates. Other researchers analyzed NTM isolated from 192 patients, and only 30% of NTM strains were correctly identified by the PRA compared to the sequencing of the hsp 65 gene, although the suggested inclusion of an additional restriction enzyme (Sm1I) increased resolution in approximately 90%.[9]

At the same time, 55.3% and 66.1% of the isolates were identified with the biochemical tests in correspondence with the sequencing of the 16S rRNA gene and the hsp 65-sequencing, respectively; these values being higher than those obtained with the PRA. These data differ from those described by other authors, as although they described that biochemical tests identified 77.9%[10] and 92%[11] of the studied strains, these percentages were relatively lower than those of PRA.

Studies conducted by da Silva Rocha et al.[15] in clinical isolates from 16 Brazilian states determined the presence of 10% of allelic variants not previously described. They included new patterns for some species such as Mycobacterium scrofulaceum, Mycobacterium intracellulare, Mycobacterium flavescens, Mycobacterium fortuitum, Mycobacterium gordonae, and Mycobacterium terrae, while other strains could not be identified, demonstrating the great diversity and biogeographic distribution of mycobacterial genotypes. Other researchers who studied NTM isolated from natural and treated waters from a zoological garden in São Paulo found only 19% of the isolates with defined PRA patterns.[29]

We observed that even when there is a 100% homology with the 16S rRNA gene sequence in the database, the correct identification of the strains with the PRA is low (36.8%). Since these strains are isolated from the environment and from geographic locations that have never been studied before, the presence of already known species with new PRA pattern is possible and even of new species.

There is some background where suspected strains with possible new patterns of PRA were actually species of the genus Nocardia.[30] The PRA technique is not used exclusively to differentiate Mycobacterium species, and this possible interference is due to the fact that both the identification of Mycobacterium and Nocardia species by PRA use the same primers described by Telenti et al.[20] for amplification of the hsp 65 gene. As Nocardia lacks the BstEII restriction site, this feature can be used in the presumptive identification of the genus.[31] In our study, all the studied isolates corresponded to the genus Mycobacterium.

According to da Silva Rocha et al.,[15] the consequences of using PRA as a unique identification procedure will depend on how much the frequencies of NTM genotypes are known in the region of interest and an additional molecular and phenotypic method will be required for each case. Some researchers[28],[32] agree that the PRA technique is not suitable for identifying new or rarely observed species and it is necessary to resort to 16S rRNA sequencing and to the analysis of mycolic acids by HPLC for definitive identification. It should be borne in mind that sequencing of the 16S rRNA gene is useful for the identification of all species, except to differentiate the species officially recognized as distinct which are characterized by genetic similarities >99% with one or more species of the genus.[14] In some of these cases, the PRA is useful for its differentiation.[22]

On the other hand, the nucleotide sequences obtained from the hsp 65 gene had a lower percentage of similarity than those found in the 16S rRNA sequenced fragments, even though the results were concordant. A similar problem has been reported previously.[16],[33] In addition, in a study using clinical isolates, the percent similarities ranged from 96.57% to 100% for the 16S rRNA gene, 89.27% to 100% for hsp 65, and 92.71% to 100% for rpo B.[34] We observed that while the probability of correct identification is low when the percentages of similarity are <99%,[12] the simultaneously use of several molecular techniques as the conventional methods increase this probability. Other researchers say that multiple, but not single, gene analysis is the approach of choice; however, this does not guarantee identification to the species level in every case.[8],[26],[34]

Biochemical tests correctly identified 87.50% of the isolates when the degree of identity in the partial sequence of the 16S rRNA gene was 100%. However, it is important that the phenotypic typing required the complementarity of this technique for the correct identification.

As for the diversity of NTM in the drinking water network, fountains of the General Pico city and in the wetlands of the influence area, it was similar to the one described in the bibliography.[1],[9],[14],[35],[36]


  Conclusion Top


Both the analysis of the restriction patterns obtained by PRA and the sequencing of the 16S rRNA and/or hsp 65 genes alone are insufficient for the precise identification of NTM, specifically when it is desired to identify mycobacteria from the environment, even more so when they are pigmented fast-growing isolates. Biochemical tests are very useful to support the data obtained by molecular techniques. The results of this work suggest that for the correct typification of NTM isolated from environmental samples, the PRA technique must be accompanied by sequencing methods and phenotypic methods. The diversity of these highly ubiquitous microorganisms leads to the constant evaluation of the usefulness of the typing methods in different contexts.

Some of the species recovered from the water samples studied have been described in cases of mycobacteriosis in Argentina, such as M. gordonae, M. intracellulare, M. fortuitum, M. vaccae, Mycobacterium lentiflavum, and Mycobacterium nonchromogenicum. These results suggest that water is a great source of NTM, which means that continuous monitoring should take place, to study the potential risk that the identified species would mean for human health.

Acknowledgment

We give special thanks to Pablo Remirez who helped us with the statistical analysis and Agustín Pellegrino Tortone and Stela Torales for the correction of this manuscript translation.

Financial support and sponsorship

This work was supported by Secretary of Research and Postgraduate Studies, UNLPam, and the Biotechnological Institute INTA, Argentina.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Kazda J, Pavlik I, Falkinham JO 3rd, Hruska K. The Ecology of Mycobacteria: Impact on Animal's and Human's Health. 1st ed. London, New York: Springer. Dordrecht Heidelberg; 2009.  Back to cited text no. 1
    
2.
Velayati AA, Rahideh S, Nezhad ZD, Farnia P, Mirsaeidi M. Nontuberculous mycobacteria in Middle East: Current situation and future challenges. Int J Mycobacteriol 2015;4:7-17.  Back to cited text no. 2
  [Full text]  
3.
Olivares L, Fandiño M, Fernández Pardal P, Pérez Cortiñas M, Maronna E. Infección cutánea por Mycobacterium chelonae. Dermatol Argent 2011;17:447-50.  Back to cited text no. 3
    
4.
Hunt C, Olivares L, Jaled M, Cergneux F, De Tezanos Pinto O, Maronna E. Infección por Mycobacterium marinum: A propósito de tres casos. Dermatol Argent 2013;19:332-6.  Back to cited text no. 4
    
5.
Imperiale B, Zumárraga M, Gioffré A, Di Giulio B, Cataldi A, Morcillo N, et al. Disease caused by non-tuberculous mycobacteria: Diagnostic procedures and treatment evaluation in the North of Buenos Aires Province. Rev Argent Microbiol 2012;44:3-9.  Back to cited text no. 5
    
6.
Gómez NA. Non-tuberculous mycobacteria: An emerging disease?. An Pediatr (Barc) 2009;71:185-8.  Back to cited text no. 6
    
7.
Oriani DS, Sagardoy MA. Nontuberculous mycobacteria in soils of La Pampa province (Argentina). Rev Argent Microbiol 2002;34:132-7.  Back to cited text no. 7
[PUBMED]    
8.
Halstrom S, Price P, Thomson R. Review: Environmental mycobacteria as a cause of human infection. Int J Mycobacteriol 2015;4:81-91.  Back to cited text no. 8
  [Full text]  
9.
da Costa AR, Lopes ML, Furlaneto IP, de Sousa MS, Lima KV. Molecular identification of nontuberculous mycobacteria isolates in a Brazilian mycobacteria reference laboratory. Diagn Microbiol Infect Dis 2010;68:390-4.  Back to cited text no. 9
[PUBMED]    
10.
Chimara E, Ferrazoli L, Ueky SY, Martins MC, Durham AM, Arbeit RD, et al. Reliable identification of mycobacterial species by PCR-restriction enzyme analysis (PRA)-hsp65 in a reference laboratory and elaboration of a sequence-based extended algorithm of PRA-hsp65 patterns. BMC Microbiol 2008;8:48.  Back to cited text no. 10
[PUBMED]    
11.
Godoy MJ, Orozco L, Hernández C, DaMata O, De Waard J, González Rico S. Identificación de micobacterias no tuberculosas: Comparación de métodos bioquímicos y moleculares. Rev Soc Venez Microbiol 2008;28:96-104.  Back to cited text no. 11
    
12.
Ong CS, Ngeow YF, Yap SF, Tay ST. Evaluation of PCR-RFLP analysis targeting hsp65 and rpoB genes for the typing of mycobacterial isolates in Malaysia. J Med Microbiol 2010;59:1311-6.  Back to cited text no. 12
[PUBMED]    
13.
Tortoli E. Standard operating procedure for optimal identification of mycobacteria using 16S rRNA gene sequences. Stand Genomic Sci 2010;3:145-52.  Back to cited text no. 13
[PUBMED]    
14.
Lee ES, Lee MY, Han SH, Ka JO. Occurrence and molecular differentiation of environmental mycobacteria in surface waters. J Microbiol Biotechnol 2008;18:1207-15.  Back to cited text no. 14
[PUBMED]    
15.
da Silva Rocha A, Werneck Barreto AM, Dias Campos CE, Villas-Bôas da Silva M, Fonseca L, Saad MH, et al. Novel allelic variants of mycobacteria isolated in Brazil as determined by PCR-restriction enzyme analysis of hsp65. J Clin Microbiol 2002;40:4191-6.  Back to cited text no. 15
    
16.
Joao I, Cristovao P, Antunes L, Nunes B, Jordao L. Identification of nontuberculous mycobacteria by partial gene sequencing and public databases. Int J Mycobacteriol 2014;3:144-51.  Back to cited text no. 16
  [Full text]  
17.
Fujimora Leite C, Ferracini R, Falcao P, David H, Lévy Prébault V. Prevalence and distribution of mycobacteria in the waters of some regions of the state of Sao Paulo- Brazil. Rev Microbiol 1989;20:432-41.  Back to cited text no. 17
    
18.
Kamala T, Paramasivan CN, Herbert D, Venkatesan P, Prabhakar R. Evaluation of procedures for isolation of nontuberculous mycobacteria from soil and water. Appl Environ Microbiol 1994;60:1021-4.  Back to cited text no. 18
[PUBMED]    
19.
Bernardelli A. Phenotypic classification of mycobacteria. Procedures manual. National Service of Agrifood Health and Quality. Bs. As., Argentina; 2007.  Back to cited text no. 19
    
20.
Telenti A, Marchesi F, Balz M, Bally F, Böttger EC, Bodmer T, et al. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J Clin Microbiol 1993;31:175-8.  Back to cited text no. 20
    
21.
Springer B, Stockman L, Teschner K, Roberts GD, Böttger EC. Two-laboratory collaborative study on identification of mycobacteria: Molecular versus phenotypic methods. J Clin Microbiol 1996;34:296-303.  Back to cited text no. 21
    
22.
Kirschner P, Böttger EC. Species identification of Mycobacteria using rDNA sequencing. In: Parish T, Stoker NG, editors. Methods in Molecular Biology: Mycobacteria Protocols. Vol. 101. Totowa, New Jersey: Humana Press Inc.; 1998. p. 349-61.  Back to cited text no. 22
    
23.
Esparcia Ó, Español M, Garrigó M, Moreno C, Montemayor M, Navarro F, et al. Use of different PCR-based techniques integrated into a non-tuberculous identification algorithm. Enferm Infecc Microbiol Clin 2012;30:3-10.  Back to cited text no. 23
    
24.
Whitman WB, Goodfellow M, Kämpfer P, Busse HJ, Trujillo ME, Ludwig W, et al., editors. Bergey's Manual of Systematic Bacteriology: The Actinobacteria Parte A. 2nd ed., Vol. 5. New York Dordrecht Heidelberg London: Springer; 2012.  Back to cited text no. 24
    
25.
Tortoli E. Microbiological features and clinical relevance of new species of the genus Mycobacterium. Clin Microbiol Rev 2014;27:727-52.  Back to cited text no. 25
[PUBMED]    
26.
Monteserin J, Paul R, Lopez B, Cnockaert M, Tortoli E, Menéndez C, et al. Combined approach to the identification of clinically infrequent non-tuberculous mycobacteria in Argentina. Int J Tuberc Lung Dis 2016;20:1257-62.  Back to cited text no. 26
    
27.
Verma AK, Kumar G, Arora J, Singh P, Arora VK, Myneedu VP, et al. Identification of mycobacterial species by PCR restriction enzyme analysis of the hsp65 gene – An Indian experience. Can J Microbiol 2015;61:293-6.  Back to cited text no. 27
[PUBMED]    
28.
Leão SC, Bernardelli A, Cataldi A, Zumarraga M, Robledo J, Realpe T, et al. Multicenter evaluation of mycobacteria identification by PCR restriction enzyme analysis in laboratories from Latin America and the Caribbean. J Microbiol Methods 2005;61:193-9.  Back to cited text no. 28
    
29.
Brianesi UA, Santiago AS, Oliveira JC, Viana Niero C. Isolamiento e identificação de micobactérias ambientais proveniestes da fundação parque zoológico de São Paulo. XXI ALAM. Resumen 017-S. Santos, Brasil; 2012. Available from: http://www.sbmicrobiologia.org.br/cdlatino/listaresumos.htm. [Last accessed on 2017 Nov 27].  Back to cited text no. 29
    
30.
Zumárraga MJ, Maito J, Gioffré A, Gavidia M, Tirante L, Aguirre N, et al. PCR-RFLP (PRA) in Mycobacteria: New patterns or other bacterial species? AVLD. XIX Technical Scientific Meeting. 1°ed. Mnemosyne Bs As, Argentina. 2012. p. 199-200.  Back to cited text no. 30
    
31.
Muricy EC, Lemes RA, Bombarda S, Ferrazoli L, Chimara E. Differentiation between Nocardia spp. and Mycobacterium spp.: Critical aspects for bacteriological diagnosis. Rev Inst Med Trop Sao Paulo 2014;56:397-401.  Back to cited text no. 31
    
32.
Ferdinand S, Legrand E, Goh KS, Berchel M, Mazzarelli G, Sola C, et al. Taxonomic and phylogenetic status of non-tuberculous mycobacteria in a Caribbean setting. Mol Cell Probes 2004;18:399-408.  Back to cited text no. 32
[PUBMED]    
33.
McNabb A, Eisler D, Adie K, Amos M, Rodrigues M, Stephens G, et al. Assessment of partial sequencing of the 65-kilodalton heat shock protein gene (hsp65) for routine identification of Mycobacterium species isolated from clinical sources. J Clin Microbiol 2004;42:3000-11.  Back to cited text no. 33
[PUBMED]    
34.
Kim SH, Shin JH. Identification of nontuberculous mycobacteria using multilocous sequence analysis of 16S rRNA, hsp65, and rpoB. J Clin Lab Anal 2017:e22184. https://doi.org/10.1002/jcla.22184. [Last accessed on 2017 Dec 12].  Back to cited text no. 34
    
35.
Le Dantec C, Duguet JP, Montiel A, Dumoutier N, Dubrou S, Vincent V, et al. Chlorine disinfection of atypical mycobacteria isolated from a water distribution system. Appl Environ Microbiol 2002;68:1025-32.  Back to cited text no. 35
    
36.
Maleki MR, Kafil HS, Harzandi N, Moaddab SR. Identification of nontuberculous mycobacteria isolated from hospital water by sequence analysis of the hsp65 and 16S rRNA genes. J Water Health 2017;15:766-74.  Back to cited text no. 36
[PUBMED]    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1], [Table 2]


This article has been cited by
1 Simple Identification of Mycobacterial Species by Sequence-Specific Multiple Polymerase Chain Reactions
Nihan Unubol,Inci Tuney Kizilkaya,Sinem Oktem Okullu,Kaya Koksalan,Tanil Kocagoz
Current Microbiology. 2019;
[Pubmed] | [DOI]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed1183    
    Printed34    
    Emailed0    
    PDF Downloaded239    
    Comments [Add]    
    Cited by others 1    

Recommend this journal