• Users Online: 281
  • Home
  • Print this page
  • Email this page


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 9  |  Issue : 1  |  Page : 18-23

Dominant marker (inter-simple sequence repeat-polymerase chain reaction) versus codominant marker (RLEP-polymerase chain reaction) for laboratory diagnosis of leprosy: A comparative evaluation


1 Department of Epidemiology, National JALMA Institute for Leprosy and Other Mycobacterial Diseases, Agra, Uttar Pradesh, India
2 Division of Epidemiology and Communicable Diseases, Indian Council of Medical Research, New Delhi, India

Date of Submission12-Apr-2019
Date of Acceptance12-Jul-2019
Date of Web Publication6-Mar-2020

Correspondence Address:
Partha Sarathi Mohanty
Department of Epidemiology, National JALMA Institute for Leprosy and Other Mycobacterial Diseases, M. Miyazaki Marg, Tajganj, Agra, Uttar Pradesh
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmy.ijmy_190_19

Rights and Permissions
  Abstract 


Background: Leprosy is a contagious disease and was eliminated globally in 2002. Since then, new cases were continuously detected from different parts of the world. Untreated leprosy cases shed millions of bacteria and are the main cause of dissemination of the disease. Currently, leprosy is detected by acid-fast bacilli (AFB) microscopy and has a low sensitivity ranging from 10% to 50%. The correlation between clinical findings and microscopy is unable to provide a conclusive case detection. Thus, in the present study, we compared to molecular methods, namely RLEP-polymerase chain reaction (RLEP-PCR) and inter-simple sequence repeat-PCR (ISSR-PCR) taking AFB microscopy as a gold standard for the detection of leprosy. Methods: A total of 168 clinically diagnosed leprosy patients were recruited in this study including 58 multibacillary and 110 paucibacillary patients. Slit-skin smear samples were taken for both microscopy and molecular study. Primers for RLEP-PCR were taken from the previous reports. The primers for ISSR-PCR were designed by screening the whole genome of Mycobacterium leprae TN strain (GenBank accession AL450380) for the presence of simple sequence repeats. One primer (TA)8CA3was synthesized and used for molecular amplification of ISSR-PCR. Results: We found that the efficacy of the AFB microscopy was 24.40%, whereas the efficacy of RLEP-PCR and ISSR-PCR was 63.09% and 73.21% (P = 0.000, 0.000, and 0.469), respectively. The area under the curve of receiver operating characteristic curve for the comparison of three diagnostic methods was 0.845. An enhancement of 48.81% in the case detection rate by ISSR-PCR over AFB microscopy and 10.12% over RLEP-PCR was also found. Our study clearly reveals that ISSR-PCR is a better tool for diagnosis of leprosy than AFB microscopy and RLEP-PCR. Interestingly, both the PCR techniques RLEP-PCR and ISSR-PCR are able to detect samples which were negative for AFB microscopy. Conclusion: Thus, the demonstration of ISSR-PCR in SSS samples can provide a better sensitive and confirmative tool for early diagnosis of leprosy.

Keywords: Acid-fast bacilli microscopy, inter-simple sequence repeat-polymerase chain reaction, laboratory diagnosis, leprosy, RLEP-polymerase chain reaction


How to cite this article:
Mohanty PS, Bansal AK, Naaz F, Patil SA, Arora M, Singh M. Dominant marker (inter-simple sequence repeat-polymerase chain reaction) versus codominant marker (RLEP-polymerase chain reaction) for laboratory diagnosis of leprosy: A comparative evaluation. Int J Mycobacteriol 2020;9:18-23

How to cite this URL:
Mohanty PS, Bansal AK, Naaz F, Patil SA, Arora M, Singh M. Dominant marker (inter-simple sequence repeat-polymerase chain reaction) versus codominant marker (RLEP-polymerase chain reaction) for laboratory diagnosis of leprosy: A comparative evaluation. Int J Mycobacteriol [serial online] 2020 [cited 2020 Jun 4];9:18-23. Available from: http://www.ijmyco.org/text.asp?2020/9/1/18/280147




  Introduction Top


The introduction of multidrug therapy (MDT) reduced the prevalence of leprosy significantly from 5.4 million cases to a few hundred thousand cases globally. In 2018, 184212 leprosy cases were registered for MDT globally with a registered prevalence rate 0.24/100,00 population.[1] Despite the global elimination of leprosy in 2002, a large number of new cases of leprosy continue to be detected every year from different countries of the world which put a hurdle in total eradication of leprosy. Leprosy is said to be transmitted from an infected individual to a healthy individual in close contact, in particular within household contacts, having the highest risk of acquiring the infection.[2],[3],[4],[5],[6] Untreated leprosy cases shed millions of bacilli into the environment, thus contributing to the spread of the disease.[7],[8],[9],[10] The causal organism of leprosy, Mycobacterium leprae, has been reported from nonhuman reservoirs and said to be contribute to the continuous transmission of the disease.[11],[12],[13],[14],[15] The main obstacle in the path of leprosy eradication is unavailability of a suitable detection method. M. leprae is an obligate parasite and cannot be cultured in any artificial medium. The unculturable property of the M. leprae put an obstacle in noneffective and nondefinitive diagnosis of leprosy. The current method for diagnosis of leprosy in field condition is based either on clinical findings or on acid-fast bacilli (AFB) staining. AFB microscopy has the advantage of being easily available at peripheral and referral centers, but as its detection limit is 104 bacilli/ml, it suffers from low sensitivity.[16] All the paucibacillary (PB) cases and some multibacillary (MB) cases essentially in borderline (BB) cases were found to be AFB negative.[17],[18] In most of the field condition, clinicians faced the problem in correct diagnosis of leprosy due to the negativity of the skin smear samples, thus leading to the delay in starting the MDT. The leprosy case detection also hampered by the unavailability of experienced leprologists in rural settings where the diagnosis is done by either paramedical workers or by accredited social health activists leads to misdiagnosis of leprosy.

Thus, in clinical practices for the case detection of leprosy, molecular detection methods have a great value in patients having negative and inconclusive diagnosis. Polymerase chain reaction (PCR) targeting RLEP repetitive sequence is widely used for the detection of M. leprae in the skin smear and tissue samples of leprosy patients both in real-time PCR format and routine PCR format.[17],[19],[20],[21] Although the sensitivity of the real-time PCR is high, it requires a highly skilled person to PCR reactions and to analyze the results, which is a constraint in the peripheral settings of rural area. The sensitivity of the routine RLEP-PCR is in between 45% and 60%.[20],[21] On the other hand, RLEP is a codominant marker yielding 129 base pair band on 2% agarose gel. Dominant markers have an advantage over codominant marker as these are hypervariable, present in multiple copies, and spread all over the genome of the organism. Thus, in the present study, an attempt has been made to evaluate the efficacy of dominant marker inter-simple sequence repeat-PCR (ISSR-PCR) for the detection of leprosy in the peripheral settings of rural area where majority of the patients are AFB negative and have early disease.


  Methods Top


Sample size calculation

The sample size was calculated as 168 taking prevalence rate as 1/10,000 and confidence interval as 95% and 400,000 population size. Thus, 168 leprosy patients were recruited in this study.

Study design and recruitment of participants

This is a population-based prospective cross-sectional study conducted from March 2015 to March 2017 in a leprosy endemic area of Western Uttar Pradesh, India. New cases of leprosy were identified and recruited for this study by house-to-house survey. Those patients having a past history of treatment received were excluded from the study. A total of 168 clinically identified leprosy patients were recruited in this study.

Leprosy cases were identified on the basis of two cardinal signs, namely (a) hypopigmented skin lesion with partial or total loss of sensation in the affected skin lesion with hair loss or in the area of the skin supplied by the peripheral nerve involved with or without the presence of thickened nerves (b) positive for AFB staining in skin smear samples.

Classification of cases

Leprosy cases were classified into five categories namely, tuberculoid (TT), borderline tuberculoid (BT), BB, borderline lepromatous, and lepromatous (LL), according to the Ridley–Jopling (RJ) classification system which classifies the leprosy cases on the basis of immunity.[22] At the same time, the cases were also classified according to the WHO classification system as PB and MB which classifies the leprosy cases on the basis of hypopigmented patches.

Microscopy

Slit-skin smear (SSS) samples were collected from all patients who were clinically diagnosed as leprosy. Four skin smear samples were taken on slides from each of the patients, two from the right and left ear lobes and two from hypopigmented patches. Direct examinations of smears were done by standard Ziehl–Neelsen (ZN) staining, and the results were tabulated. The slides were graded positively for the presence of M. leprae and in its absence as negative. Bacteriological index was also taken at the time of grading for all positive slides. Although ZN staining has low sensitivity (10%–50%), the technique was taken as the reference test due to its nearly 100% specificity.[23]

Extraction of DNA

DNA extraction was done by the method described by Donoghue et al.[24] In brief, TE buffer containing slit-skin samples was centrifuged at 21,000 rpm for 10 min, TE buffer was discarded, and 700 μl of extraction buffer was added to the pellet and mixed by vortexing. The mixture was incubated at 65°C for 1 h, and an equal volume of chloroform–isoamyl alcohol (24:1) was added, vortexed, and centrifuged for 10 min at 10,000 g. The aqueous phase was precipitated with cold isopropanol and centrifuged at 10,000 g for 10 min. The pellet was washed with 70% ethanol, air-dried, and resuspended in 15 μl of TE buffer. The DNA samples were quantified in a BioPhotometer (Eppendorf) for the absorbance at 260 nm (for DNA), 280 nm (for protein), and 230 nm (for RNA). Samples were diluted to 20 ng/μl for conducting further experimentation process.

Screening of inter-simple sequence repeats

ISSRs were screened from the full genome of M. leprae TN strain (AL450380) using the software tandem repeat finder (Benson 1999). Primers for four short tandem repeats (AT)8(CA)3, (CAA)4, (GT)7, and (CCAG)3 were synthesized and screened for the amplification of M. leprae DNA. From these four repeats, (AT)8(CA)3 was taken for the further study as it showed better amplification of M. leprae DNA than the other three repeats.

Amplification of RLEP

PCR amplification of M. leprae-specific repetitive sequence (RLEP) was carried out using the protocol described by Naaz et al.[20] PCR reaction was carried out in 25 μL of PCR reaction mix consisting of 2.5 μL of DNA, 200 μM of dNTP mix (Genie, Bangalore), 1X reaction buffer (Genie, Bangalore), 1.5 mM MgCl2(Genie, Bangalore), 1 unit of hot start Taq DNA polymerase (Genie, Bangalore), and 0.4 μM of each primer (LP1 and LP2).[24] The sequence of forward primer is 5'TGCATGTCATGGCCTTGAGG3' and the reverse primer is 5'CACCGATACCAGCGGCAGAA3'. The amplification was done in ABI Master Cycler 9700. Amplification was performed using following parameters: 95°C for 5 min for initial denaturing temperature, followed by 95°C for 2 min (denaturation), 58°C for 1 min (annealing), and 72°C for 1 min (extension) for 45 cycles and a final extension step of 10 min at 72°C. In the last step of the PCR amplification, the temperature was held at 4°C.

Amplification of inter-simple sequence repeat

The M. leprae-specific ISSR region was amplified using the same reaction mixture condition and temperature conditions described for RLEP amplification except the primer and annealing temperature. As a dominant marker, the ISSR marker has a single primer and the sequence is 5'TATATACATACATACATATATA3'. The annealing temperature was set to 59°C. A flowchart representing the workflow is illustrated in [Figure 1]. Positive and negative controls were included in both of the experiments.
Figure 1: Experimental flow diagram describing the total number of leprosy patients recruited and conclusive diagnosis of leprosy by three methods, namely acid-fast bacilli microscopy, RLEP-polymerase chain reaction, and inter-simple sequence repeat-polymerase chain reaction

Click here to view


Data analysis

The statistical significance of the differences in sensitivities among RLEP-PCR, ISSR-PCR, and SSS microscopy was measured by means of Chi-square test and Fisher's exact test. SPSS (version 21; Chicago, IL, USA) was used for statistical analysis. The receiver operating characteristic (ROC) curve was analyzed for PCR diagnosis with the WHO clinical types by online tool easy ROC.[25]


  Results Top


Participants and acid-fast bacilli microscopy

A total of 168 patients were included in this study who met the criteria of case definition of leprosy. The profile of the leprosy cases was studied whether the patient falls into PB (TT and BT) or MB (BT, BB, and LL) cases, after physical and clinical examination. Out of 168 patients recruited, 58 (34.52%) were found to be MB patients and 110 (65.47%) were PB patients. The profile of the disease according to the RJ classification system is provided in [Table 1]. In case of AFB microscopy, 41 (24.40%) cases were found to be AFB positive and 127 (75.59%) were AFB negative. The positivity of the AFB staining is categorically presented in [Table 1].
Table 1: Acid-fast bacilli results of recruited patients in this study

Click here to view


Screening of inter-simple sequence repeat

BLAST search of the ISSR region 5'TATATACATACATACATATATATATATA3' revealed that the repeat is highly specific to M. leprae although two other organisms, namely Calothrix sp. and Ureaplasma parvum, showed 100% query coverage to the searched sequence [Figure 2]. Calothrix is a cyanobacterium and does not report any human disease, whereas Ureaplasma parvum is a mycoplasma and a commensal of female genital organ and does not report any skin disease.
Figure 2: BLAST search of inter-simple sequence repeat showing the specificity toward Mycobacterium leprae strains

Click here to view


RLEP-polymerase chain reaction experiments

A total of 106 (63.09%) patients were found to be positive for RLEP-PCR out of 168 patients. Out of 106 patients who were RLEP-PCR positive, 49 (84.84%) were MB and 57 (51.81%) were PB leprosy types [Figure 3] and showed a 129 bp band product on 2% agarose gel [Figure 4] and [Table 2]. All the 41 AFB-positive cases were found to be RLEP-PCR positive, whereas from 127 AFB-negative patients, 69 (54.33%) were positive and 58 (45.66%) were negative for RLEP-PCR.
Figure 3: Comparison between sensitivities of acid-fast bacilli microscopy, RLEP-polymerase chain reaction, and inter-simple sequence repeat-polymerase chain reaction (The Chi-square test values: acid-fast bacilli microscopy and RLEP-polymerase chain reaction 36.010 (P = 0.000), acid-fast bacilli microscopy and inter-simple sequence repeat-polymerase chain reaction 42.783 (P = 0.000), and RLEP-polymerase chain reaction and inter-simple sequence repeat-polymerase chain reaction 0.525 (P = 0.469)

Click here to view
Figure 4: Amplification of 129 base pair RLEP sequence of Mycobacterium leprae. M denotes the 1 Kb molecular marker and P stand for patient samples

Click here to view
Table 2: Comparisons between acid-fast bacilli staining, Mycobacterium leprae-specific repetitive sequence-polymerase chain reaction, and inter-simple sequence repeats-polymerase chain reaction

Click here to view


Inter-simple sequence repeat-polymerase chain reaction experiments

A total of 123 (73.21%) patients were found to be positive for ISSR-PCR. Among the 123 patients who were ISSR-PCR positive, 51 (87.93%) were MB and 72 (65.54%) were PB leprosy patients [Figure 3] and showed a 500 bp–1.5 Kb band products on 2% agarose gel [Figure 5] and [Table 2]. All the 41 AFB-positive cases were found to be ISSR-PCR positive, whereas from 127 AFB-negative patients, 86 (67.71%) were positive and 41 (32.28%) were negative for ISSR-PCR.
Figure 5: Amplification of inter-simple sequence repeat sequences of Mycobacterium leprae showing bands ranging from 400 base pairs to 900 base pairs. M denotes the 1 Kb molecular marker and P stand for patient samples

Click here to view


Significance of statistical analysis

The comparative statistical analysis between AFB microscopy and RLEP-PCR, AFB microscopy and ISSR-PCR, and RLEP-PCR and ISSR-PCR yielded a significant P value for the Fisher's exact test. (P < 0.0001, 0.0001, and 0.5054, respectively). The Chi-square test values for these comparisons were 36.010 (P = 0.000) for AFB microscopy and RLEP-PCR, 42.783 (P = 0.000) for AFB microscopy and ISSR-PCR, and 0.525 (P = 0.469) for RLEP-PCR and ISSR-PCR.

ROC curve analysis was performed for PCR with the WHO classification. The diagnostic accuracy was calculated as 0.845 (area under the curve [AUC] = 0.853, 95% confidence interval = 0.726–0.927) [Figure 6].
Figure 6: Comparison of receiver operating characteristic curve for three detection methods

Click here to view



  Discussion Top


The main tool for diagnosis of leprosy is AFB staining along with clinical findings. However, AFB staining is a conventional technique and has low sensitivity. In the absence of sensitive diagnostic tool, the total elimination of leprosy is impossible. Thus, there is a need for developing new sensitive diagnostic tool for early diagnosis of leprosy. Several reports from different laboratories showed the better efficacy of PCR-based diagnostic tests over AFB microscopy.[20],[24],[26],[27],[28],[29],[30],[31] Therefore, in the present study, we compared AFB microscopy with RLEP-PCR and ISSR-PCR for diagnosis of leprosy.

In this study, only 41 (24.40%) cases were found to be AFB microscopy positive out of 168 cases, whereas 106 (63.09%) were RLEP-PCR positive and 123 (73.21%) were ISSR-PCR positive. Therefore, the result showed the better efficacy of ISSR-PCR over RLEP-PCR and AFB microscopy. The significance of the test results was also evident from the P value of the t-test statistics.[21],[32] The AUC 0.845 of ROC curve also points to the better diagnostic value of ISSR-PCR over other two diagnostic methods.[21],[25] The low sensitivity of SSS microcopy is due to individual observer variation and low load of bacteria in SSS. We demonstrated an enhancement of 48.81% in the case detection rate by ISSR-PCR over AFB microscopy and 10.12% over RLEP-PCR. The 10.12% increase in case detection by ISSR-PCR over RLEP-PCR can be explained by the dominancy nature of the ISSR-PCR having multiple copies in the entire genome of an organism.[32],[33] The RLEP-PCR and ISSR-PCR sensitivities could have been increased by increasing the blade strokes at the time of sample collection. The current result was observed in three blade strokes.

Furthermore, in AFB microscopy, PB cases were not detected due to low load of bacilli, whereas in RLEP-PCR, the positivity of the PB cases was 51.81%, and in ISSR-PCR, it was 65.45% which showed the better efficacy of ISSR-PCR over other two techniques in case of low bacilli load patients.


  Conclusion Top


Our study clearly reveals that ISSR-PCR is a better tool for diagnosis of leprosy than AFB microscopy and RLEP-PCR. Interestingly, both the PCR techniques RLEP-PCR and ISSR-PCR are able to detect samples which were negative for AFB microscopy. Thus, the demonstration of ISSR-PCR in SSS samples can provide a better sensitive and confirmative tool for early diagnosis of leprosy.

Acknowledgments

The authors are highly grateful to the Indian Council of Medical Research, New Delhi, for providing financial assistance for this study. We are also thankful to Archana Raikwar, Shailendra Chauhan, Momd Wasim, Pradip Mishra, Ashok Tiwari, Jitendra Chaurasia, Mahendra Singh, Shivkaran, Ram Singh, Nause, Pawan, Raju, and Anita for their constant support in the field at the time of sample collection and transportation.

Financial support and sponsorship

This study was financially supported by the Indian Council of Medical Research.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
World Health Organization. Weekly Epidemiological Record. Vol. 94. Geneva: World Health Organization; 2019. p. 389-412.  Back to cited text no. 1
    
2.
Rees RJ, McDougall AC. Airborne infection with Mycobacterium leprae in mice. J Med Microbiol 1977;10:63-8.  Back to cited text no. 2
    
3.
Fine PE, Sterne JA, Pönnighaus JM, Bliss L, Saui J, Chihana A, et al. Household and dwelling contact as risk factors for leprosy in Northern Malawi. Am J Epidemiol 1997;146:91-102.  Back to cited text no. 3
    
4.
Moet FJ, Pahan D, Schuring RP, Oskam L, Richardus JH. Physical distance, genetic relationship, age, and leprosy classification are independent risk factors for leprosy in contacts of patients with leprosy. J Infect Dis 2006;193:346-53.  Back to cited text no. 4
    
5.
Salgado CG, Barreto JG. Leprosy transmission: Still a challenge. Acta Derm Venereol 2012;92:335.  Back to cited text no. 5
    
6.
Cabral-Miranda W, Chiaravalloti Neto F, Barrozo LV. Socio-economic and environmental effects influencing the development of leprosy in Bahia, North-Eastern Brazil. Trop Med Int Health 2014;19:1504-14.  Back to cited text no. 6
    
7.
van Beers SM, de Wit MY, Klatser PR. The epidemiology of Mycobacterium leprae: Recent insight. FEMS Microbiol Lett 1996;136:221-30.  Back to cited text no. 7
    
8.
Kerr-Pontes LR, Barreto ML, Evangelista CM, Rodrigues LC, Heukelbach J, Feldmeier H. Socioeconomic, environmental, and behavioural risk factors for leprosy in North-East Brazil: Results of a case-control study. Int J Epidemiol 2006;35:994-1000.  Back to cited text no. 8
    
9.
Franco-Paredes C, Rodriguez-Morales AJ. Unsolved matters in leprosy: A descriptive review and call for further research. Ann Clin Microbiol Antimicrob 2016;15:33.  Back to cited text no. 9
    
10.
Holanda MV, Marques LE, Macedo ML, Pontes MA, Sabadia JA, Kerr LR, et al. Presence of Mycobacterium leprae genotype 4 in environmental waters in Northeast Brazil. Rev Soc Bras Med Trop 2017;50:216-22.  Back to cited text no. 10
    
11.
Blake LA, West BC, Lary CH, Todd JR 4th. Environmental nonhuman sources of leprosy. Rev Infect Dis 1987;9:562-77.  Back to cited text no. 11
    
12.
Matsuoka M, Izumi S, Budiawan T, Nakata N, Saeki K. Mycobacterium leprae DNA in daily using water as a possible source of leprosy infection. Indian J Lepr 1999;71:61-7.  Back to cited text no. 12
    
13.
Lahiri R, Krahenbuhl JL. The role of free-living pathogenic amoeba in the transmission of leprosy: A proof of principle. Lepr Rev 2008;79:401-9.  Back to cited text no. 13
    
14.
Saha K, Jain M, Mukherjee MK, Chawla NM, Chaudhary DS, Prakash N. Viability of Mycobacterium leprae within the gut of Aedes aegypti after they feed on multibacillary lepromatous patients: A study by fluorescent and electron microscopes. Lepr Rev 1985;56:279-90.  Back to cited text no. 14
    
15.
Mohanty PS, Naaz F, Katara D, Misba L, Kumar D, Dwivedi DK, et al. Viability of Mycobacterium leprae in the environment and its role in leprosy dissemination. Indian J Dermatol Venereol Leprol 2016;82:23-7.  Back to cited text no. 15
[PUBMED]  [Full text]  
16.
Shepard CC, McRae DH. A method for counting acid-fast bacteria. Int J Lepr Other Mycobact Dis 1968;36:78-82.  Back to cited text no. 16
    
17.
Martinez AN, Talhari C, Moraes MO, Talhari S. PCR-based techniques for leprosy diagnosis: From the laboratory to the clinic. PLoS Negl Trop Dis 2014;8:e2655.  Back to cited text no. 17
    
18.
Yan W, Xing Y, Yuan LC, De Yang R, Tan FY, Zhang Y, et al. Application of RLEP real-time PCR for detection of M. leprae DNA in paraffin-embedded skin biopsy specimens for diagnosis of paucibacillary leprosy. Am J Trop Med Hyg 2014;90:524-9.  Back to cited text no. 18
    
19.
Martinez AN, Lahiri R, Pittman TL, Scollard D, Truman R, Moraes MO, et al. Molecular determination of Mycobacterium leprae viability by use of real-time PCR. J Clin Microbiol 2009;47:2124-30.  Back to cited text no. 19
    
20.
Naaz F, Katoch K, Mohanty PS, Chauhan DS, Yadav VS, Kumar A, et al. Use of RLEP-PCR as a molecular. Tool and definitive laboratory test from skin smear scrapings for early diagnosis of leprosy in field situations. Indian J Lepr 2016;88:199-207.  Back to cited text no. 20
    
21.
Siwakoti S, Rai K, Bhattarai NR, Agarwal S, Khanal B. Evaluation of polymerase chain reaction (PCR) with slit skin smear examination (SSS) to confirm clinical diagnosis of leprosy in Eastern Nepal. PLoS Negl Trop Dis 2016;10:e0005220.  Back to cited text no. 21
    
22.
Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966;34:255-73.  Back to cited text no. 22
    
23.
International Leprosy Association. Report of the international leprosy association technical forum: Epidemiology and control. Lepr Rev 2002;73:46.  Back to cited text no. 23
    
24.
Donoghue HD, Holton J, Spigelman M. PCR primers that can detect low levels of Mycobacterium leprae DNA. J Med Microbiol 2001;50:177-82.  Back to cited text no. 24
    
25.
Goksuluk D, Korkmaz S, Zararsiz G, Karaagaoglu AE. Easy ROC: An interactive web-tool for ROC curve analysis using R language environment. R J 2016;8:213-30.  Back to cited text no. 25
    
26.
Cox RA, Kempsell K, Fairclough L, Colston MJ. The 16S ribosomal RNA of Mycobacterium leprae contains a unique sequence which can be used for identification by the polymerase chain reaction. J Med Microbiol 1991;35:284-90.  Back to cited text no. 26
    
27.
Kang TJ, Kim SK, Lee SB, Chae GT, Kim JP. Comparison of two different PCR amplification products (the 18-kDa protein gene vs. RLEP repetitive sequence) in the diagnosis of Mycobacterium leprae. Clin Exp Dermatol 2003;28:420-4.  Back to cited text no. 27
    
28.
Phetsuksiri B, Rudeeaneksin J, Supapkul P, Wachapong S, Mahotarn K, Brennan PJ. A simplified reverse transcriptase PCR for rapid detection of Mycobacterium leprae in skin specimens. FEMS Immunol Med Microbiol 2006;48:319-28.  Back to cited text no. 28
    
29.
Banerjee S, Sarkar K, Gupta S, Mahapatra PS, Gupta S, Guha S, et al. Multiplex PCR technique could be an alternative approach for early detection of leprosy among close contacts – A pilot study from India. BMC Infect Dis 2010;10:252.  Back to cited text no. 29
    
30.
Martinez AN, Ribeiro-Alves M, Sarno EN, Moraes MO. Evaluation of qPCR-based assays for leprosy diagnosis directly in clinical specimens. PLoS Negl Trop Dis 2011;5:e1354.  Back to cited text no. 30
    
31.
Motulsky HJ, Neubig RR. Analyzing binding data. Curr Protoc Neurosci 2010;52:1-65.  Back to cited text no. 31
    
32.
Ravi Kumar A, Sathish V, Balakrish Nair G, Nagaraju J. Genetic characterization of Vibrio cholerae strains by inter simple sequence repeat-PCR. FEMS Microbiol Lett 2007;272:251-8.  Back to cited text no. 32
    
33.
Mo QH, Wang HB, Tan H, An SL, Feng ZL, Wang Q, et al. Optimization and head-to-head comparison of MISSR-PCR, ERIC-PCR, RAPD and 16S rRNA evolutionary clock for the genotyping of Vibrio cholerae isolated in China. Indian J Med Microbiol 2015;33:516-23.  Back to cited text no. 33
[PUBMED]  [Full text]  


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed538    
    Printed42    
    Emailed0    
    PDF Downloaded101    
    Comments [Add]    

Recommend this journal