• Users Online: 952
  • Home
  • Print this page
  • Email this page


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 9  |  Issue : 2  |  Page : 156-166

VapBC and MazEF toxin/antitoxin systems in the regulation of biofilm formation and antibiotic tolerance in nontuberculous mycobacteria


Institute of Ecology and Genetic of Microorganisms, Perm Federal Research Center, Ural Branch RAS, Perm, Russia

Date of Web Publication29-May-2020

Correspondence Address:
Daria V Eroshenko
Goleva 13, Perm 614010
Russia
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmy.ijmy_61_20

Rights and Permissions
  Abstract 


Background: Mycobacterium smegmatis and other nontuberculous mycobacteria (NTM) are widely distributed in the environment, but a significant increase of NTM infections has taken place in the last few decades. The objective of this study was to determine the role of toxin–antitoxin (TA) vapBC and mazEF systems that act as effectors of persistence in the stress response of NTM. Methods: The growth ability and the biofilm formation of NTM were evaluated by conventional methods. Bacterial cell viability was determined using MTT staining, agar plating, or the method of limiting dilutions. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of antibiotics were estimated using broth and agar dilution methods. Results: Despite a comparable growth dynamics and biofilm formation on solid/liquid interface with the wild type, a M. smegmatis vapBC, mazEF, and vapBC × mazEF deletion mutant produced more abundant pellicle and were more susceptible to heat shock. Significant differences were also found in the resistance wild type of NTM to isoniazid and ciprofloxacin reflected by higher MBC/MIC ratios. The proposed method of cultivation of agar blocks without visible growth after MIC determination into a liquid medium allows us to detect transition of all wild type of NTM strains to a dormant state in the presence of subMICs of isoniazid and ciprofloxacin while all deletion mutants failed to form dormant cells. Conclusion: Our data suggest that both vapBC and mazEF TA systems putatively involved in the heat and antibiotic stress response of NTM via their key role in transition to the dormant state.

Keywords: Antibiotic, dormant, Mycobacteria, toxin–antitoxin


How to cite this article:
Eroshenko DV, Polyudova TV, Pyankova AA. VapBC and MazEF toxin/antitoxin systems in the regulation of biofilm formation and antibiotic tolerance in nontuberculous mycobacteria. Int J Mycobacteriol 2020;9:156-66

How to cite this URL:
Eroshenko DV, Polyudova TV, Pyankova AA. VapBC and MazEF toxin/antitoxin systems in the regulation of biofilm formation and antibiotic tolerance in nontuberculous mycobacteria. Int J Mycobacteriol [serial online] 2020 [cited 2020 Jul 11];9:156-66. Available from: http://www.ijmyco.org/text.asp?2020/9/2/156/285234




  Introduction Top


Toxin–antitoxin (TA) systems are widespread among bacteria, but their physiological roles have only recently been revealed.[1] These systems were initially characterized as components of low-copy-number plasmids and later discovered on bacterial chromosomes.[2] TA systems consist of a stable toxin that can cause cell death by disrupting an essential cellular process and a labile antitoxin that can prevent the toxin from exerting its toxicity by forming a complex with toxin.[3],[4] There are three types of TA systems, and they differ primarily in the interactions between the toxin and the antitoxin to form the benign complex. Type II TA systems including mazEF and vapBC families of toxins are composed of protein antitoxin and toxin pairs and are the most prevalent and best-characterized TAs.[5] The number of TA systems in the genome of Mycobacterium tuberculosis (MTB) has been greatly expanded with 88 putative TA systems present,[1] whereas Mycobacterium smegmatis contains only three TA systems (vapBC, mazEF, and phd/doc).[6] In the last decade, it has become clear that gene pairs, TA systems, act as effectors of dormancy and persistence.[7],[8],[9]

Several studies have been performed to identify the role of TA systems in biofilms and in response to antibiotic treatment. A five-TA deletion strain of Escherichia coli where the mazEF, relBE, yefM-yoeB, chpB, and dinJ-yafQ TA systems have been deleted had reduced initial biofilm formation and reduced biofilm dispersal.[10] At the same time, overexpression of mazF toxin drives to the inhibition of biofilm formation, but promotes biofilm antibiotic tolerance in Staphylococcus aureus.[11] However, MazF-deficient MTB mutant strains showed the similar biofilm formation pattern in both the parental and single-mutant strains.[12] Regarding antibiotic resistance, Zhao et al. believed that the increased viability of MTB drug-resistant strains compared to drug-sensitive strains is related to differential MazEF expression.[13] This fact may reflect the conclusion of Sat et al. about mazEF-mediated death of E. coli triggered by the presence of antibiotics that inhibit transcription and/or translation.[14]

The term nontuberculous mycobacteria (NTM) encompass a large number (>150) Mycobacterium species.[15] NTM have been shown to be normal residents of drinking water distribution systems and premise plumbing; in fact, they grow in distribution systems between the treatment plant and buildings.[16] But now, NTM are more often responsible for respiratory tract colonization/infection, infections related to medical procedures and disseminated infections in immunocompromised patient.[17]

Our purpose in this study was to investigate the potential role of this TA system in the stress response of NTM. For this, the survival properties of deletion mutants were compared to the wild-type parent strain and two-type NTM strains (M. smegmatis and Mycobacterium avium) during biofilm formation, heat shock, and antibiotic treatment. Thus, the current study is aimed at uncovering the contributions of vapBC and mazEF to the stress response of NTM.


  Methods Top


Bacterial culture conditions

The following strains of NTM were used: M. smegmatis GISK 107, M. avium GISK 168, M. smegmatis mc2 155 (wild type-wt), the △vapBC, △mazEF, and △vapBC × △mazEF mutants. M. smegmatis mc2 155 △vapBC, △mazEF, and △vapBC × △mazEF mutants were kindly provided by Dr. Anna V. Goncharenko and Dr. Michael S. Shumkov from Federal Research Centre “Fundamentals of Biotechnology” of the Russian Academy of Sciences where they have been constructed as previously described.[8],[18] The deletions of vapBC and mazEF were confirmed by polymerase chain reaction (PCR).

All studied NTM strains were grown in Middlebrook 7H9 medium at 37°C with shaking (160 rpm) until the exponential phase (40–48 h). At this point, bacterial cells were twice washed with 0.1% Tween 60 (v/v; Sigma, USA), suspended in the same solution, and vigorously shaken on a Multi Vortex V-32 during 15–20 min to prepare a single cell suspension at a final concentration of 1–1.5 × 108 CFU/ml.

Total DNA isolation

Total DNA isolation was performed according to the reagent kit protocol for isolation of bacterial genomic DNA (DiaGene, Russia) with minor modifications.[19] NTM strains were grown in Middlebrook 7H9 medium at 37°C with shaking (160 rpm) for 3 days. Cells were resuspended into 10 mM TBE buffer (pH 8.0), heated at 80°C for 1 h, and maintained at − 20°C for 12 h to unstuck cell wall. Then, the mycobacterial cells were suspended in 100 μl of STET Solution (8% sucrose, 5% Triton X-100, 50 mM EDTA, 50 mM TrisHCl, pH 8.0). Lysozyme was added to cell pellet in a two-fold volume and kept for 24 h (instead of 20 min). Then, the samples were centrifuged; the pellet was further lysed by proteinase K for 3 h (instead of 10 min). Total DNA was recovered by removing the supernatant after centrifugation and resuspending the pellet in 10 mM Tris HCl buffer (pH 8.5) to a final volume of 100 μl.

Amplification of DNA by polymerase chain reaction and sequencing

For M. smegmatis GISK 107, M. avium GISK 168, M. smegmatis mc2 155 wt, and △vapBC × △mazEF, mutant PCR amplification was performed from purified total DNA. Based on the sequence alignment of the vapC and mazF TA genes in the National Center for Biotechnology Information database, pairs of fixed primers specific to each TA system were designed to amplify internal fragments with sizes 526 bp for vapC and 102 bp for mazF. The sequences of primers were following for vapC (Forw CTAGCGGCACGTACGGGGGAGAC and Rev TTGGCGAGCGCATAGGAAAAACAG) and for mazF (Forw AAGCCTCGGCCGGTCCTCATCATC and Rev CAGAAGCGGTGCGTCGGTGTCG).

PCR amplification was performed in a final volume of 25 μl containing 1 μl of purified total DNA, 2.5 μl of 10x PCR buffer and 1.5 μl of 25 mM MgCl2 (Syntol, Russia), 2.0 μl of 2.5 mM each deoxynucleoside triphosphate, 1 μl of DMSO, 1 μl of 10 μM each primer, and 0.6 μl of 5 units/μl of Taq polymerase (Syntol, Russia). PCR was carried out in a C1000 Touch™ Thermal Cycler (Bio Rad Laboratories, USA), with an initial denaturation step (95°C, 5 min); 4 cycles of denaturation (95°C, 30 s), annealing (58°C for vapC, 62°C for mazF, 30 s), and extension (72°C, 40 s); 29 cycles of denaturation (95°C, 30 s), annealing (56°C for vapC, 60°C for mazF, 30 s), and extension (72°C, 40 s); followed by a final extension step (72°C, 1 min 30 s). PCR amplification products were analyzed by agarose gel electrophoresis in 1% agarose and stained with ethidium bromide.

PCR products of M. smegmatis GISK 107, M. avium GISK 168, and M. smegmatis mc2 155 wt generated from custom primers for vapC were sequenced by Big Dye Terminator v3.1 and an ABI automatic sequence analyzer (model 3500 × l; Applied Biosystems, USA). Sequence data were analyzed using Sequence Scanner v2.0, MEGA7.0 and the BLAST to verify the identity of the PCR products and sequence identity to known genes.

Nontuberculous mycobacteria growth dynamics

To compare growth dynamics, M. smegmatis GISK 107, M. avium GISK 168, the M. smegmatis mc2 155 wild-type strain and the △vapBC, △mazEF, and △vapBC×△mazEF mutants were resuspended into Middlebrook 7H91-1.5 × 108 CFU/ml, and then 20 ml of each resuspension was placed in duplicate into a sterile flask. The flasks were incubated for 7 days with shaking (160 rpm) at 37°C and the biomass and number of viable cells was determined daily. To determine the biomass of cells, a suspension of NTM after settling for 1 min to precipitate large lumps was measured at OD600. Bacterial cell viability was determined by staining of a carefully mixed suspension of NTM with MTT (1 mg/ml) for 2 h with overnight extraction of the dye by 10% Tween-80 in 45% ethanol and subsequent measurement of OD570.[20]

Biofilm assay

The assay was performed in triplicate using 40-mm polystyrene Petri dishes. Briefly, NTM suspensions at a final concentration of 1–1.5 × 108 CFU/ml were prepared in medium with sodium lactate (yeast extract – 5 g, KH2 PO4 – 1 g, Na2 HPO4 × 2H2O – 3 g, sodium lactate (70%) – 40 ml per 1 l of Milli-Q water). The Petri dishes with 3 ml of NTM suspensions were incubated 3 days at 37°C to allow biofilm formation. The Petri dish with medium only was used as a negative control. Then, the contents of each Petri dish were divided on three subpopulations (pellicle, planktonic cells, and bottom biofilm). Hence, to remove pellicle at the air–liquid interface, PBS was added to the liquid medium under the pellicle until one was raised above. Then, the lid of the Petri dish was carefully applied to the pellicle surface, so that the pellicle completely adhered to the lid surface due to its hydrophobicity. The liquid part containing the planktonic cells was transferred to a test tube and centrifuged (5 min, 12,000 rpm), the supernatant was removed, and the pellet was used for the staining. The bottom biofilm was stained in the original Petri dish. The biomass of each type of subpopulations was determined by the staining with 3 ml of 0.1% violet crystal for 20 min at room temperature, washed with distilled water at least three times to remove excess dye and allowed to dry at room temperature. The extraction of violet crystal was carried out with 95% ethanol. The optical density at 570 nm was read using a Benchmark Plus (BioRad, USA). Bacterial cell viability of each subpopulation was determined by MTT staining as described above.

Heat shock

Stress experiments were performed with stationary phase (OD600 ~ 3.0) cultures of NTM grown in Middlebrook 7H9 medium during 20 days. For heat shock (60°C), the cells were diluted to OD600 ~ 0.15, then precipitated, resuspended into Middlebrook 7H9, and placed at the indicated temperature for 15 min without further manipulation. Bacterial cell viability before and after heat stress was monitored by cell counts based on CFU/ml where serial dilutions of bacterial cell culture in phosphate-buffered saline were spread onto Middlebrook 7H9 agar plates.

In addition, the most probable number of cells capable of growth in liquid media before and after heat stress was determined by the method of limiting dilutions in Middlebrook 7H9 medium. For this, 180 μl of medium was added to each well of 96-well plate, and then 20 μl of the bacterial suspension was added to the first well of the row, mixed, and transferred to the next well.[21] Agar plates and 96-well plates were incubated at 37°C for 4–5 days. The bacterial cell growth in the plate was accessed by staining with 20 μl of 2, 3, 5-triphenyl-tetrazolium chloride solution (TTC, 2 μg/ml). The most probable number of cells (CFU/ml) was determined using the McCrady's tables.[22]

Determination of minimum inhibitory concentration and minimum bactericidal concentration by Broth Microdilution

For the estimation of the minimum inhibitory concentrations (MICs) of isoniazid, rifampicin, ciprofloxacin, and erythromycin for all studied NTM, we used the two-fold broth microdilution method as previously described.[23] Briefly, serial two-fold dilutions of antibiotics starting from 250 μg/ml of isoniazid, rifampicin, and erythromycin and 2.5 μg/ml of ciprofloxacin were added to Middlebrook 7H9 broth. Aliquots of mycobacterial cells were then inoculated to a final concentration of 105 CFU/ml. After incubation at 37°C for 4 days, the MICs were determined as the lowest concentrations of compound that prevented visible growth.

To assess whether antibiotics have a bacteriostatic or bactericidal effect, we determined minimum bactericidal concentration (MBC). Briefly, at day 4 of incubation and after the MIC reading, wells without visible growth were chosen to test the viability of the mycobacteria. Ten microliters from each well at the MIC and all higher concentrations were transferred to wells of 96-well polystyrene plates with 200 μl of fresh medium. The plates were incubated for 4 days. The MBC was defined as the lowest drug concentration prevented visible growth after transferring to liquid medium without antibiotic.

Determination of minimum inhibitory concentration and minimum bactericidal concentration by agar dilution

First, we determined MIC99 on the agar plates as the antibiotic concentration that prevents the growth of 99% of NTM cells. To measure MIC99, we plated at least 106 bacterial cells/spot on Middlebrook 7H9 agar plates containing two-fold dilutions of isoniazid (6.25–800 μg/ml), rifampicin (6.25–800 μg/ml), and ciprofloxacin (0.25–2 μg/ml). Plates were then incubated at 37°C for 5 days. The lowest concentration of antibiotic where all three agar plates for a single concentration showed weak, thread-like growth with single colonies was defined as MIC99.[24] MBCagar was determined as the lowest concentration of antibiotic where all three agar plates for a single concentration showed zero colonies. Then, the inoculums spots (diameter 8 mm) from the agar plate corresponding to MBCagar and all higher concentrations were sterilely cut, transferred into Middlebrook 7H9 broth, and cultivated at 37°C for 7 days. The bacterial cell growth was accessed by visible alteration of the optical density. The minimum inhibitory concentration for dormant cells on the corresponding agar plate (MICdormant) was defined as the lowest drug concentration that prevents the visible growth of NTM cells.


  Results Top


Presence of toxin–antitoxin genes in nontuberculous mycobacteria

In an effort to define the presence of TA systems in type strains of NTM differing M. smegmatis mc2 155, PCR was used to probe the total DNA preparations from M. smegmatis GISK 107, M. avium GISK 168. The results of this PCR analysis of the total DNA content of all NTM are displayed in [Figure 1]. Examination of these data reveals that TA systems are ubiquitous in the genome of these NTM; in fact, there were two studied TA systems in M. smegmatis GISK 107 and M. avium GISK 168. DNA sequencing was performed for PCR products of vapBC TA system. These sequencing data confirmed the identity of the TA system for three studied strains (M. smegmatis mc2 155, M. smegmatis GISK 107, and M. avium GISK 168), because the sequenced products had >99% sequence identity with reference sequence of M. smegmatis mc2 155 (CP009494) (M. smegmatis mc2 155 wt, 100% identity; M. smegmatis GISK 107, 99.58% identity; M. avium GISK 168, 99.57% identity; sequences are shown in supplementary).
Figure 1: The presence of genes of toxin–antitoxin systems vapBC (a) and mazEF (b) in type strains of nontuberculous mycobacteria. Lines: 1 – MW, 2 – Mycobacterium smegmatis mc2 155 wt, 3 – Mycobacterium smegmatis mc2 155 △ vapBC × △mazEF, 4 – Mycobacterium smegmatis GISK 107, 5 – M. avium GISK 168, 6 – negative control

Click here to view


Nontuberculous mycobacteria growth dynamics

To study the role of the TA modules in M. smegmatis, general growth characteristics of the TA deletion mutants (△vapBC, △mazEF, and △vapBC × △mazEF) in comparison with the wild-type and two NTM strains were analyzed. We did not observe significant phenotypic differences in growth dynamics of biomass for the single △mazEF and double △vapBC × △mazEF mutants compared to wild type [Figure 2]a. Whereas, ΔvapBC mutant showed a slightly smaller increase in biomass and the number of viable cells and longer lag phase compared to parent strain.
Figure 2: Growth dynamics of biomass (a) and the bacterial cell viability (b) of nontuberculous mycobacteria and toxin–antitoxin system mutants in Middlebrook 7H9

Click here to view


Both NTM strains (M. smegmatis GISK 107 and M. avium GISK 168) were also characterized by a smaller increase in biomass and the number of viable cells compared to M. smegmatis mc2 155 wt. It should be noted that only the biomass of nonaggregated bacteria was taken into account when measuring the optical density (OD600). At the same time, M. smegmatis GISK 107 and M. avium GISK 168 characterized by a high degree of cohesion with the formation of large agglomerates that quickly settled to the flask bottom. In this regard, we also evaluated the microbial development using MTT colorimetric assay, based on enzymatic reduction of light colored tetrazolium salts to strongly colored formazan product [Figure 2]b. Moreover, the dynamics of the respiratory activity of cells was comparable with the pattern of biomass accumulation. The calculation of the growth rate (μ) and doubling time (t½) based on MTT data revealed that mutant ΔmazEF showed the fastest growth and shorter doubling time of the number of living cells, whereas these parameters for M. smegmatis wt and ΔvapBC mutant did not differ significantly [Table 1].{Figure 2}
Table 1: Growth parameters of nontuberculous mycobacteria and toxin-antitoxin system mutant strains

Click here to view


Biofilm assay

Mycobacteria can develop biofilm not only on solid surfaces but also on the air–media interface.[25] This phenomenon may be explained by the different composition of the extracellular matrix of the biofilm and the unique characteristics of mycobacterial cell wall, especially the presence of high lipid levels. The formation of pellicle and solid–liquid interface biofilm was also observed for M. smegmatis, Mycobacterium Fortuitum, and Mycobacterium chelonae in MH broth[26] for M. smegmatis mc2 155 in Sauton's medium[27] for Mycobacterium bovis in Middlebrook 7H9[28] and M. avium.[29]

To characterize the role of TA systems in the differential spatial distribution of the biofilm, the biofilm of M. smegmatis GISK 107, M. avium GISK 168, the M. smegmatis mc2 155 wild type strain and the △vapBC, △mazEF, and △vapBC×△mazEF mutants on a polystyrene surface and air-liquid interface was monitored by CV and MTT staining [Figure 3].
Figure 3: Biomass (a) and viability (b) of bottom and pellicle biofilms formed by nontuberculous mycobacteria grown in medium with sodium lactate

Click here to view


The distribution of biomass in three fractions (pellicle, planktonic cells, and bottom biofilm) does not occur evenly. Hence, the biomass and number of viable cells in planktonic fraction for all NTM strains, including mutants, was equal and insignificant (less 1% of total biomass and total number of viable cells). The biomass of pellicle biofilm was almost 3-5 times higher than the biomass of bottom biofilm for all studied NTM strains [Figure 3]a. It is noteworthy that the pellicle biomass of type NTM strains (M. smegmatis mc2 155, M. smegmatis GISK 107, and M. avium GISK 168) was almost 2-times less than one for the mutants. At the same time, despite differences in pellicle biomass, the number of viable cells in this type biofilm determined by MTT was similar for the different strains, except for the double ΔvapBC × ΔmazEF mutant [Figure 3]b. Probably, the double mutant most actively synthesized the intercellular matrix constituting pellicle biofilm, which is easily stained by CV but not MTT. While M. smegmatis mc2 155 wt apparently produced less intercellular substance in comparison with the mutant strains. In addition, we noticed a difference in the growth pattern of the pellicle. The folding structure was characteristic for wild type and △vapBC knockout mutant, while the surface of pellicle of mutants with single △mazEF and double △vapBC × △mazEF were more homogeneous [Figure 4].{Figure 3}
Figure 4: Pellicles of Mycobacterium smegmatis mc2 155 wt and mutant strains in medium with sodium lactate: top view (a) and side view (b)

Click here to view


Thus, the growth physiology of wild-type bacteria and deletion mutants at the early stages of growth do not differ significantly. However, we believed that obvious differences in phenotypes can be detected under the stress factors such heat shock and antibiotics, since the role of the TA genes is directly related to the bacterial adaptation to stress-related conditions.[9]

Heat shock

We investigated if the TA modules of M. smegmatis were beneficial to a stationary growing culture exposed to stress conditions. Thus, the resistance of stationary growing culture (20 days, 7H9 medium) to heat shock (15 min, 60°C) was studied. It was shown that the cells of three type NTM strains (M. smegmatis mc2 155, M. smegmatis GISK 107, M. avium GISK 168) were highly resistant to heat stress (<3 log CFU). Whereas, the number of mutant cells reduced at least 4 log CFU after the temperature treatment [Figure 5]. Moreover, the strains with vapBC deletion were the most sensitive. Probably, the dormant state of bacteria, the transition to which occurs in the stationary growth phase, contributes to the appearance of high resistance of cells to unfavorable factors, including high temperatures. It should be noted that the number of viable bacteria of M. smegmatis GISK 107, M. avium GISK 168 and M. smegmatis mc2 155 wt determined by the limiting dilutions method [Figure 4]b was on 2 orders of magnitude higher than corresponding values for agar plating method [Figure 4]a. Perhaps this is due to the presence of dormant cells that could not to grow on solid medium in the heterogeneous stationary culture.
Figure 5: Susceptibility of nontuberculous mycobacteria strains to heat stress condition (15 min, 60°C). The number of viable bacteria was determined by agar plating (a) and limiting dilutions (b) methods

Click here to view


Determination of minimum inhibitory concentration and minimum bactericidal concentration

Type II TA systems have been described as terminal effectors of bacterial persistence, because bacteria overexpressing these ribonucleases become drug tolerant by suppressing their metabolism. We investigated the contribution of TA system to the persistence of NTM on treatment with drugs with different mechanisms of action in vitro.

MIC and MBC results determined by microdilution of isoniazid, rifampicin, ciprofloxacin, and erythromycin are shown in [Table 2]. The MIC and MBC values of isoniazid for the various mutant strains were the same (31.25 and 62.5 μg/ml, respectively) and significantly exceeded the corresponding values for parent strain (3.9 and 7.81 μg/ml, respectively). Other type NTM strains (M. smegmatis GISK 107 and M. avium GISK 168) occupied an intermediate position on isoniazid resistance with MIC and MBC values 7.81 and 15.6 μg/ml, respectively. The MIC for rifampicin was 15.62 μg/ml for almost all studied NTM strains, except △mazEF mutant strain. For all NTM strains, the highest sensitivity was noted to ciprofloxacin, whose MICs were in the range of 0.078–0.15 μg/ml. Furthermore, ciprofloxacin had a significantly higher MBC compared to the respective MIC for M. avium GISK 168, the wild-type M. smegmatis mc2 155, and △mazEF mutant strains, suggesting a bacteriostatic effect. On the other hand, △vapBC and △vapBC × △mazEF mutant strains had similar values of MIC and MBC for ciprofloxacin, suggesting a bactericidal effect. Both the wild-type and mutant strains of M. smegmatis mc2 155 exhibited similar unsusceptibilities to erythromycin, suggesting that erythromycin persisters are formed through a mechanism independent of TA system.
Table 2: Minimum inhibitory concentrations and minimum bactericidal concentration range for nontuberculous mycobacteria strains determined by microdilution

Click here to view


Determination of MIC99 and MBCagar by agar dilution allows to estimate the degree of heterogeneity of bacterial cultures and to reveal the presence of antibiotic-resistant cells within the bacterial population sensitive to the antibiotic. Due to the high MIC and MBC values (0.3–2.5 mg/ml) for erythromycin [Table 2], MIC99 and MBCagar by agar dilution were not determined for this antibiotic. MIC99 was read as the lowest concentration that inhibited growth 99.9% of cells reflected by thread-like structures or that allowed no more than single colonies to grow. MIC99 and MBCagar obtained with agar dilution [Table 3] were higher than those obtained with broth microdilution [Table 2]. However, both methods demonstrate a greater sensitivity of type NTM strains to antibiotics in comparison with TA system deletion mutants. Mutant strains again showed equally higher of MIC99 values to isoniazid compare to parent strain and other NTM strains, but the sensitivity to rifampicin and ciprofloxacin reflected in MIC99 values was approximately the same.
Table 3: Minimum inhibitory concentrations99, minimum bactericidal concentrationagar and minimum inhibitory concentrationsdormant range for nontuberculous mycobacteria strains determined by agar dilution

Click here to view


Taking into account the presence of TA system genes in type NTM strains, we did not expect their death under antibiotics, but predicted the transition of the majority of the population to a dormant state, so we also determined MICdormant values. Hence, MICdormant was determined as the lowest concentration that inhibited the visible growth after transferring the sections of agar without visible bacterial growth from agar plates corresponding to MBCagar values and higher into 7H9 medium and subsequent cultivation for 7 days [Table 3]. The greatest difference between the strains was revealed in the analysis MBCagar and MICdormant values and their ratio. Hence, M. smegmatis mc2 155 wt, M. avium GISK 168, and M. smegmatis GISK 107 did not form any colonies on agar plates starting only with 25, 200, and 100 μg/ml of isoniazid, respectively, but after transferring the sections of agar without visible bacterial growth from agar plates corresponding to 1 × MBCagar, 2 × MBCagar, and 4 × MBCagar of isoniazid into 7H9 medium and subsequent cultivation for 5–7 days, we observed the formation of mycobacterial pellicules. The ratios of MICdormant/MBCagar were equal to 4 for rifampicin and ≥8 for ciprofloxacin for all type NTM strains. Whereas, for mutant strains, MBCagar of isoniazid, rifampicin, and ciprofloxacin tended to be only one to two dilutions less than the MICdormant values. It should be noted that the MBCagar of ciprofloxacin was not definitely determined for all studied strains because single colonies (from 2 to 20 for different strains) appeared in inoculum spots for all tested concentrations probably formed by cells that were initially resistant to ciprofloxacin.

Thus, all antibiotics again showed a clear bacteriostatic effect for wild-type NTM strains unlike to mutant strains. Moreover, the evaluation of the effect of antibiotics via the determination of MIC and MBC by broth or agar dilution gives a false positive result, since a transition of mycobacterial cells from dormancy to a metabolically active state does not occur in the presence of subinhibitory doses of the antibiotic, but is only possible when optimal conditions are created.


  Discussion Top


NTM are widespread in nature, where they habited in water and soil. The formation of aerosols containing NTM from storm water, soil, and natural bodies of water indicates that these niches can be sources of infection.[30] In addition, genetic analysis has proven that clinical isolates are identical to isolates from domestic tap water, bathrooms, and garden soil.[31] It has long been thought that NTMs are typical saprophytes. However, at present, diseases caused by bacteria of this group are increasingly being diagnosed. The most common infections caused by M. abscessus and M. avium complexes.[31],[32] At the same time, there are cases of infections caused by the rapidly growing mycobacteria M. smegmatis, the pathogenicity of which has long been called into question[33],[34] Therefore, the study of the physiology of NTM, their adaptive abilities under stress, the launch of programmed cell death processes, or the formation of dormant forms is not only fundamental, but also of great practical importance.

The genome of M. smegmatis harbors only three TA systems[1]VapBC, MazEF, phd/doc and therefore represents an attractive model to uncover the role (s) of TA systems in a mycobacterial species. Many studies have sought to define a role for TA systems through overexpression of TA systems in the native host and in nonnative hosts (i.e., typically E. coli). The formation of drug-tolerant persisters in M. smegmatis along with reversible bacteriostasis had been observed at expression of Rc1102c in M. smegmatis,[35] Frampton et al. reported that no phenotype was identified for deletions of the individual TA systems, but a triple deletion strain (vapBC, mazEF, and phd/doc) exhibited a survival defect in complex growth medium demonstrating an essential role for these TA modules in mycobacterial survival.[6]

However, the majority of studies on the TA system have relied on the overexpression of the toxin to identify its physiological effects. However, it was shown that VapB antitoxin can bind MazF toxin.[36] We here revisited M. smegmatis with deletions of the individual TA systems (vapBC and mazEF) and double deletion strain (vapBC and mazEF) in order to shed new light on the function of this TA system. We believe as Curtis et al.[37] that only comparison the presence or absence of the mazEF and vapBC loci may be correct since the overexpression could have not reflective of this TA system in its natural state. According to our results the deletion of TA systems did not lead to a significant change in phenotype. However, we observed a slight increase in the lag phase for mutants with vapBC deletion and low respiratory activity of these cells during this period compared to the wild type [Figure 2]. The slight difference in our observations and Frampton et al. results[6] may be due to the fact that their measurements of OD600 and the number of living cells by agar plating (CFU/ml) may not reflect the natural state of the microbial population growth due to the different degree of coaggregation of mycobacterial cells of different strains even in the presence of detergent (Tween 80),[38] but detected by microscopy (data not shown). In this study, we used MTT staining, which indicates the number of actively breathing cells, which allow us to assess the degree of their metabolic activity and consequently, the population growth rate more accurately. Hence, mutants with single deletion of mazEF and even for double deletion of vapBC and mazEF showed higher metabolic activity and an earlier onset of the exponential growth phase than wild type strain [Figure 2] and [Table 1]. Increased grow rate of ΔmazEF mutants may be connected with a reduction in hydrophobicity as has been showed in the MATH test with hexadecane (data not shown). Indeed, less hydrophobic opaque colonial variants of M. avium grow more rapidly than hydrophobic transparent colonial variants.[39]

Although the association between NTM biofilms and human disease is still recent, being unequivocally proven only for few species, mycobacteria easily form different types of biofilms in vitro which intensively studied.[40] Biofilms confer resistant properties on bacteria and are usually generated when the bacteria are exposed to conditions of adversity, including nutrient depletion and the presence of microbial inhibitors. The most penetrating insights into the role of TAs in biofilm organization come from research on E. coli biofilms, biofilm formation of which are involved several TA systems, e.g., mazFE, mqsRA, hipAB, hhA–tomB, and yafQ–dinJ.[4] Hence, the simultaneous deletion of 5 TA systems in E. coli has been shown to suppress fimbriae, thereby leading to inhibition of biofilm formation.[10] However, there was no association between presence of MazF gene and biofilm formation on the clinical isolates of E. coli.[41] Recently the ability of mazF to inhibit biofilm formation of S. aureus and promote biofilm antibiotic tolerance was shown.[11] In contrast to the results obtained in E. coli and S. aureus, biofilm formation was similar in both the parental and single-mutant strains consistent with observations with various MazF-deficient MTB mutant strains.[12] In addition, Lemos et al. demonstrated that mutants lacking homologues of the mazF and relE genes in Streptococcus mutans had no effect on biofilm formation compared to parental strains.[42] Here, the differences in biofilm formation between different type NTM strains carrying the both TA systems were not apparent in contrast to their ability to grow [Figure 2] and [Figure 3]. However, we observed that mutants with the single deletion of vapBC or mazEF showed approximately the same pattern of bottom biofilm formation as the wild type. But the increased biomass of pellicle biofilm [Figure 3] along with visible changes in the nature of the pellicle [Figure 4] was observed for all mutants that suggest that the pellicle formation of M. smegmatis is influenced by the action of multiple TA systems. Previously, the role of vapBC-type TA modules in the control the lipid composition of cell wall has been shown for bat/bto gene in Bradyrhizobium japonicum.[43] A detailed characterization of the role of TA systems in lipid composition of M. smegmatis awaits further studies.

Several stressful conditions, including high temperatures, DNA damage, and oxidative stress, also induce mazEF-mediated cell death in E. coli.[3] The vapBC system also seems to play an important role in bacterial persistence at stress.[8],[44] Here, heat shock revealed the difference between type NTM strains and mutants. So, TA mutants were being more sensitive to heat shock than the wild type [Figure 5]. A similar reaction was also previously shown for triple deletion strain of M. smegmatis. The triple mutant was also more sensitive to H2O2 stress compared with the wild type.[6] Moreover, knocking out a specific vapBC locus in Sulfolobus solfataricus substantially changed the transcriptome and in one case, rendered the crenarchaeon heat-shock-labile.[45] We also noticed the differences in the determination of viable cells after heat shock by agar plating and limited dilution methods, that may be associated with the generation of dormant cells characterized by low metabolic status and transient inability to grow on solid medium and proliferate.[46]

Thus, we have demonstrated that of stationary growing culture of M. smegmatis mc2 155 wt, M. smegmatis GISK 107, M. avium GISK 168 exposed to heat shock resulted in generation of dormant cells, whereas, all TA knockout strains were failed to form dormant “nonculturable” cells [Figure 5]. This possibility is supported by the fact that the role of vapBC system in dormancy transition has been previously shown for M. smegmatis ΔvapBC knockout strain at K+-deficient medium.[8]

According to previous studies, under stress conditions, toxin can target diverse cellular processes, such as translation, DNA replication, and cell wall synthesis, leading to the inhibition of cell growth, a switch to a dormant state, and responding to various stress conditions.[47],[48] Previous studies have shown the involvement of the TA systems, especially type II TA system, in persister cell formation and antibiotic tolerance in many bacteria.[49] So, it has been suggested that mazEF-mediated death of E. coli can be triggered by various stressful conditions that inhibit the expression of mazEF. These conditions include the inhibition of transcription by the presence of antibiotics that inhibit transcription and/or translation (rifampin, chloramphenicol, and spectinomycin).[14] Moreover, the increased viability of MTB drug-resistant strains compared with drug-sensitive strains is likely to be related to differential MazEF mRNA and protein expression.[13] Considering the function of the TA systems, we assumed that this system could be also involved in responding to antibiotic stress in NTM strains.

Notably, all deletion strains were more resistant towards isoniazid, which is often used against MTB, reflected by an increase in the MIC compare to parent stain [Table 2]. Apparently, both vapBC and mazEF TA systems apparently play a key role in the formation of dormant in wild-type mycobacteria under the isoniazid action. At the same time, the high sensitivity of all studied NTM strains to ciprofloxacin, but not rifampicin with similar mechanism of blocking DNA replication has been identified. Interestingly, the double deletion of vapBC and mazEF mutants had the same ratio MBC/MIC for ciprofloxacin as the single deletion of vapBC mutants. Previously, the formation of persisters of E. coli in response to ciprofloxacin treatment and their dependence on tisAB TA system has been investigated.[7] Therefore, we believe that the presence of vapBC TA systems allows type NTM strains unlike strains with a single deletion of vapBC and double deletion of vapBC and mazEF to go into a persistent namely dormant state under the influence of low concentrations of ciprofloxacin and resume their growth under optimal conditions which reflected by an increase in range of MIC and MBC values [Table 2].

Despite the fact that the dilution broth method according to the CLSI recommendations is the “gold standard” for determining the antibiotic sensitivity of mycobacteria, we compared it with the agar dilution method.[50] In general, there was a fairly good correlation between results obtained with broth microdilution and agar dilution for the rapidly growing pathogenic mycobacteria.[51] However, we noted that MICs obtained by agar dilution [Table 3] are almost 2–3 times higher than those obtained by broth microdilution [Table 2], which may be associated with a different dose of inoculums (106 vs. 104 CFU/ml).

However, the new method that we proposed for culturing agar blocks without visible growth of mycobacteria in a liquid medium allows us to detect bacteria that have transition to a dormant state in the presence of subinhibitory and inhibitory concentrations of the antibiotic and retained the ability to reverse to a cultivable state under optimal conditions. So, the results of MIC determination agar dilution showing that the survival of all three mutants was significantly decreased when compared to the wild type strain in the presence of ciprofloxacin especially [Table 3]. Previously, the used in this study M. smegmatis ΔvapBC knockout strain was failed to form dormant “nonculturable” cells at K+-deficiency reflected by a decrease in CFU number and uracil incorporation in contrast to wild type.[8] A common feature of type II TA systems is a toxic enzyme activity that switches bacterial cells over to metabolic stasis under stressful conditions such as starvation as well as heat, osmotic and free radical-induced stress.[52] Indeed, VapC toxin homologues from MTB inhibited growth when expressed without their cognate VapB antitoxins in M. smegmatis.[53]

The agar dilution method allowed us to determine not only MIC99 and MBC, but also to reveal a range of concentrations that contribute to the selection of mutant bacteria resistant to this antibiotic. Since we used rather high doses of inoculum in the agar dilution method, then MBC in this study reflected the mutant prevention concentration (MPC), which measures the MIC of the most resistant sub-population and equal. The concentrations between MIC and MPC, defined as the mutant selection window (MSW), signify the antibiotic concentration range for which evolution of resistance can occur by selecting for the nonsusceptible portion of the population.[54] While the MPC and MSW have been widely described in MTB as defined values,[55] the precise data concerning the MPC and MSW for NTM are lacking. Here, we noted that the MSW of isoniazid for mutant strains was significantly narrower than for the parent strain and other typical strains [Table 3]. Typically, the frequency of persister formation increases with cell density and reaches about 1% in stationary phase.[56] Gain-of-function mutants in the E. coli hipA toxin gene lead to an increase in the frequency of ampicillin- and fluoroquinolone-tolerant persisters in a growing population from 1 in 10,000 cells or less (wild-type levels) to 1 in 100 cells.[57] However, these persisters were slow- or nongrowing cells.[58] Moreover, MTB persister formation involves multiple pathways, including genes involved in lipid biosynthesis, carbon metabolism, TA systems.[59] Our results therefore predicted that M. smegmatis cells lacking any type II TA loci (vapBC or mazEF, or both) exhibit a reduced level of persisters. Moreover, since environmental factors affect TA activity, it is possible that the levels of persisters can be modulated by the environment via TA system. However, we could not accurately enough determine the MPC of ciprofloxacin. So, all strains had single colonies at a concentration of 2 mg/ml, which was significantly higher than MICs for these strains. This phenomenon requires further comprehensive study.

An obvious conclusion to be drawn from this is that, without the toxin presence to facilitate a state of bacteriostasis, the organism could continue to replicate under conditions that would normally allow toxin activation followed by growth arrest. Our data suggest that the loss of the ability to modulate replication is increases antibiotic resistance but reduces dormancy. Moreover, it appears to be true for mycobacteria only among Gram-positive bacteria, as no changes in the level of persister cells (a proxy for dormancy) could be observed in △mazEF knockouts of S. aureus[60] as well as under natural circumstances Listeria monocytogenes did not accumulate in high enough concentrations of MazF toxin to induce dormancy.[37]


  Conclusion Top


Thus, the results presented in this study demonstrate that vapBC and mazEF TA systems contribute to the ability of NTM to (i) adapt to heat shock, (ii) become drug-resistant, and (iii) transition to persist state. In addition, we conclude that VapC and MazF toxins may be appropriate targets for combating dormant bacteria.

Financial support and sponsorship

RFFR 18-34-00333 mol_a.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Slayden RA, Dawson CC, Cummings JE. Toxin-antitoxin systems and regulatory mechanisms in Mycobacterium tuberculosis. Pathog Dis 2018;76:fty039.  Back to cited text no. 1
    
2.
Gerdes K, Christensen SK, Løbner-Olesen A. Prokaryotic toxin-antitoxin stress response loci. Nat Rev Microbiol 2005;3:371-82.  Back to cited text no. 2
    
3.
Hazan R, Sat B, Engelberg-Kulka H. Escherichia coli mazEF-mediated cell death is triggered by various stressful conditions. J Bacteriol 2004;186:3663-9.  Back to cited text no. 3
    
4.
Kędzierska B, Hayes F. Emerging Roles of Toxin-Antitoxin Modules in Bacterial Pathogenesis. Molecules 2016;21:790.  Back to cited text no. 4
    
5.
Lee KY, Lee BJ. Structure, biology, and therapeutic application of toxin-antitoxin systems in pathogenic bacteria. Toxins (Basel) 2016;8:305.  Back to cited text no. 5
    
6.
Frampton R, Aggio RB, Villas-Bôas SG, Arcus VL, Cook GM. Toxin-antitoxin systems of Mycobacterium smegmatis are essential for cell survival. J Biol Chem 2012;287:5340-56.  Back to cited text no. 6
    
7.
Dörr T, Vulić M, Lewis K. Ciprofloxacin causes persister formation by inducing the TisB toxin in Escherichia coli. PLoS Biol 2010;8:e1000317.  Back to cited text no. 7
    
8.
Demidenok OI, Kaprelyants AS, Goncharenko AV. Toxin-antitoxin vapBC locus participates in formation of the dormant state in Mycobacterium smegmatis. FEMS Microbiol Lett 2014;352:69-77.  Back to cited text no. 8
    
9.
Page R, Peti W. Toxin-antitoxin systems in bacterial growth arrest and persistence. Nat Chem Biol 2016;12:208-14.  Back to cited text no. 9
    
10.
Kim Y, Wang X, Ma Q, Zhang XS, Wood TK. Toxin-antitoxin systems in Escherichia coli influence biofilm formation through YjgK (TabA) and fimbriae. J Bacteriol 2009;191:1258-67.  Back to cited text no. 10
    
11.
Ma D, Mandell JB, Donegan NP, Cheung AL, Ma W, Rothenberger S, et al. The toxin-antitoxin mazef drives Staphylococcus aureus biofilm formation, antibiotic tolerance, and chronic infection. mBio 2019;10:1-15.  Back to cited text no. 11
    
12.
Tiwari P, Arora G, Singh M, Kidwai S, Narayan OP, Singh R. MazF ribonucleases promote Mycobacterium tuberculosis drug tolerance and virulence in guinea pigs. Nat Commun 2015;6:6059.  Back to cited text no. 12
    
13.
Zhao JL, Liu W, Xie WY, Cao XD, Yuan L. Viability, biofilm formation, and MazEF expression in drug-sensitive and drug-resistant Mycobacterium tuberculosis strains circulating in Xinjiang, China. Infect Drug Resist 2018;11:345-58.  Back to cited text no. 13
    
14.
Sat B, Hazan R, Fisher T, Khaner H, Glaser G, Engelberg-Kulka H. Programmed cell death in Escherichia coli: Some antibiotics can trigger mazEF lethality. J Bacteriol 2001;183:2041-5.  Back to cited text no. 14
    
15.
Marras TK, Daley CL. Epidemiology of human pulmonary infection with nontuberculous mycobacteria. Clin Chest Med 2002;23:553-67.  Back to cited text no. 15
    
16.
Falkinham JO 3rd, Norton CD, LeChevallier MW. Factors influencing numbers of Mycobacterium avium, Mycobacterium intracellulare, and other Mycobacteria in drinking water distribution systems. Appl Environ Microbiol 2001;67:1225-31.  Back to cited text no. 16
    
17.
Tortoli E. Clinical manifestations of nontuberculous mycobacteria infections. Clin Microbiol Infect 2009;15:906-10.  Back to cited text no. 17
    
18.
Zamakhaev MV, Goncharenko AV, Shumkov MS. Role of toxin-antitoxin systems in formation of phenotypic stability of Mycobacterium smegmatis to tetracycline. In: The Scientific Conference of Young Scientists on Medical Biological FSBI FSCC Physico-Chemical Medicine FMBA. Ilyina EN, Kostryukova ES. editors. Moscow: FNCC PCM FMBA of Russia; 2016. p. 172.  Back to cited text no. 18
    
19.
Kumar P, Marathe S, Bhaskar S. Isolation of genomic DNA from Mycobacterium Species. Bio-protocol. 2016;6:e1751.  Back to cited text no. 19
    
20.
Mshana RN, Tadesse G, Abate G, Miörner H. Use of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide for rapid detection of rifampin-resistant Mycobacterium tuberculosis. J Clin Microbiol 1998;36:1214-9.  Back to cited text no. 20
    
21.
Mulyukin AL, Kudykina YK, Shleeva MO, Anuchin AM, Suzina NE, Danilevich VN. et al. Intraspecies diversity of dormant forms of Mycobacterium smegmatis. Microbiology (Mikrobiologiya) 2010;79:461-71.  Back to cited text no. 21
    
22.
Tillett HE. Most probable numbers of organisms: Revised tables for the multiple tube method. Epidemiol Infect 1987;99:471-6.  Back to cited text no. 22
    
23.
Niki M, Niki M, Tateishi Y, Ozeki Y, Kirikae T, Lewin A, et al. A novel mechanism of growth phase-dependent tolerance to isoniazid in mycobacteria. J Biol Chem 2012;287:27743-52.  Back to cited text no. 23
    
24.
European Committee for Antimicrobial Susceptibility Testing (EUCAST) of the European Society of Clinical Microbiology and Infectious Dieases (ESCMID). EUCAST definitive document E.DEF 3.1, June 2000: Determination of minimum inhibitory concentrations (MICs) of antibacterial agents by agar dilution. Clin Microbiol Infect 2000;6:509-15.  Back to cited text no. 24
    
25.
Ojha AK, Baughn AD, Sambandan D, Hsu T, Trivelli X, Guerardel Y, et al. Growth of Mycobacterium tuberculosis biofilms containing free mycolic acids and harbouring drug-tolerant bacteria. Mol Microbiol 2008;69:164-74.  Back to cited text no. 25
    
26.
Sousa S, Bandeira M, Carvalho PA, Duarte A, Jordao L. Nontuberculous mycobacteria pathogenesis and biofilm assembly. Int J Mycobacteriol 2015;4:36-43.  Back to cited text no. 26
  [Full text]  
27.
Ojha AK, Jacobs WR, Hatfull GF. Genetic dissection of mycobacterial biofilms. In: Parish T, Roberts D, editors. Mycobacteria Protocols. Methods in Molecular Biology. New York: Humana Press; 2015. p. 215-26.  Back to cited text no. 27
    
28.
Tripathi D, Chandra H, Bhatnagar R. Poly-L-glutamate/glutamine synthesis in the cell wall of Mycobacterium bovis is regulated in response to nitrogen availability. BMC Microbiol 2013;13:226.  Back to cited text no. 28
    
29.
Totani T, Nishiuchi Y, Tateishi Y, Yoshida Y, Kitanaka H, Niki M, et al. Effects of nutritional and ambient oxygen condition on biofilm formation in Mycobacterium avium subsp. hominissuis via altered glycolipid expression. Sci Rep 2017;7:41775.  Back to cited text no. 29
    
30.
Honda JR, Virdi R, Chan ED. Global environmental nontuberculous mycobacteria and their contemporaneous man-made and natural niches. Front Microbiol 2018;9:2029.  Back to cited text no. 30
    
31.
Nishiuchi Y, Iwamoto T, Maruyama F. Infection sources of a common non-tuberculous mycobacterial pathogen, Mycobacterium avium complex. Front Med (Lausanne) 2017;4:27.  Back to cited text no. 31
    
32.
Shin SH, Jhun BW, Kim SY, Choe J, Jeon K, Huh HJ, et al. Nontuberculous mycobacterial lung diseases caused by mixed infection with Mycobacterium avium complex and Mycobacterium abscessus complex. Antimicrob Agents Chemother 2018;62:e01105-18.  Back to cited text no. 32
    
33.
Belda Alvarez M, Chanza Aviño M, Sanfeliu Giner M, Guna Serrano MR, Gimeno Cardona C. Infection of prosthetic material due to Mycobacterium smegmatis. Rev Esp Quimioter 2019;32:475-6.  Back to cited text no. 33
    
34.
Agrawal T, Fuentes Rojas S, Adigun R, Badam M. A rare catch in a nonhealing wound. Wounds 2018;30:E87-8.  Back to cited text no. 34
    
35.
Han JS, Lee JJ, Anandan T, Zeng M, Sripathi S, Jahng WJ, et al. Characterization of a chromosomal toxin-antitoxin, Rv1102c-Rv1103c system in Mycobacterium tuberculosis. Biochem Biophys Res Commun 2010;400:293-8.  Back to cited text no. 35
    
36.
Zhu L, Sharp JD, Kobayashi H, Woychik NA, Inouye M. Noncognate Mycobacterium tuberculosis toxin-antitoxins can physically and functionally interact. J Biol Chem 2010;285:39732-8.  Back to cited text no. 36
    
37.
Curtis TD, Takeuchi I, Gram L, Knudsen GM. The Influence of the Toxin/Antitoxin mazEF on Growth and Survival of Listeria monocytogenes under Stress. Toxins (Basel) 2017;9:31.  Back to cited text no. 37
    
38.
DePas WH, Bergkessel M, Newman DK. Aggregation of nontuberculous Mycobacteria is regulated by carbon-nitrogen balance. mBio 2019;10:e01715-19.  Back to cited text no. 38
    
39.
Stormer RS, Falkinham JO 3rd. Differences in antimicrobial susceptibility of pigmented and unpigmented colonial variants of Mycobacterium avium. J Clin Microbiol 1989;27:2459-65.  Back to cited text no. 39
    
40.
Faria S, Joao I, Jordao L. General overview on nontuberculous Mycobacteria, biofilms, and human infection. J Pathog 2015;2015:809014.  Back to cited text no. 40
    
41.
Karimi S, Ghafourian S, Taheri Kalani M, Azizi Jalilian F, Hemati S, Sadeghifard N. Association between toxin-antitoxin systems and biofilm formation. Jundishapur J Microbiol 2015;8:e14540.  Back to cited text no. 41
    
42.
Lemos JA, Brown TA Jr., Abranches J, Burne RA. Characteristics of Streptococcus mutans strains lacking the MazEF and RelBE toxin-antitoxin modules. FEMS Microbiol Lett 2005;253:251-7.  Back to cited text no. 42
    
43.
Miclea PS, Péter M, Végh G, Cinege G, Kiss E, Váró G, et al. Atypical transcriptional regulation and role of a new toxin-antitoxin-like module and its effect on the lipid composition of Bradyrhizobium japonicum. Mol Plant Microbe Interact 2010;23:638-50.  Back to cited text no. 43
    
44.
Keren I, Minami S, Rubin E, Lewis K. Characterization and transcriptome analysis of Mycobacterium tuberculosis persisters. mBio 2011;2:e00100-11.  Back to cited text no. 44
    
45.
Cooper CR, Daugherty AJ, Tachdjian S, Blum PH, Kelly RM. Role of vapBC toxin-antitoxin loci in the thermal stress response of Sulfolobus solfataricus. Biochem Soc Trans 2009;37:123-6.  Back to cited text no. 45
    
46.
Dhillon J, Lowrie DB, Mitchison DA. Mycobacterium tuberculosis from chronic murine infections that grows in liquid but not on solid medium. BMC Infect Dis 2004;4:51.  Back to cited text no. 46
    
47.
Yamaguchi Y, Park JH, Inouye M. Toxin-antitoxin systems in bacteria and Archaea. Annu Rev Genet 2011;45:61-79.  Back to cited text no. 47
    
48.
Chan WT, Balsa D, Espinosa M. One cannot rule them all: Are bacterial toxins-antitoxins druggable? FEMS Microbiol Rev 2015;39:522-40.  Back to cited text no. 48
    
49.
Wang X, Kim Y, Hong SH, Ma Q, Brown BL, Pu M, et al. Antitoxin MqsA helps mediate the bacterial general stress response. Nat Chem Biol 2011;7:359-66.  Back to cited text no. 49
    
50.
Brown-Elliott BA, Woods GL. Antimycobacterial susceptibility testing of nontuberculous Mycobacteria. J Clin Microbiol 2019;57:e00834-19.  Back to cited text no. 50
    
51.
Woods GL, Bergmann JS, Witebsky FG, Fahle GA, Wanger A, Boulet B, et al. Multisite reproducibility of results obtained by the broth microdilution method for susceptibility testing of Mycobacterium abscessus, Mycobacterium chelonae, and Mycobacterium fortuitum. J Clin Microbiol 1999;37:1676-82.  Back to cited text no. 51
    
52.
Pedersen K, Christensen SK, Gerdes K. Rapid induction and reversal of a bacteriostatic condition by controlled expression of toxins and antitoxins. Mol Microbiol 2002;45:501-10.  Back to cited text no. 52
    
53.
Ahidjo BA, Kuhnert D, McKenzie JL, Machowski EE, Gordhan BG, Arcus V, et al. VapC toxins from Mycobacterium tuberculosis are ribonucleases that differentially inhibit growth and are neutralized by cognate VapB antitoxins. PLoS One 2011;6:e21738.  Back to cited text no. 53
    
54.
Drlica K, Zhao X. Mutant selection window hypothesis updated. Clin Infect Dis 2007;44:681-8.  Back to cited text no. 54
    
55.
Rodríguez JC, Cebrián L, López M, Ruiz M, Jiménez I, Royo G. Mutant prevention concentration: Comparison of fluoroquinolones and linezolid with Mycobacterium tuberculosis. J Antimicrob Chemother 2004;53:441-4.  Back to cited text no. 55
    
56.
Keren I, Kaldalu N, Spoering A, Wang Y, Lewis K. Persister cells and tolerance to antimicrobials. FEMS Microbiol Lett 2004;230:13-8.  Back to cited text no. 56
    
57.
Moyed HS, Bertrand KP. hipA, a newly recognized gene of Escherichia coli K-12 that affects frequency of persistence after inhibition of murein synthesis. J Bacteriol 1983;155:768-75.  Back to cited text no. 57
    
58.
Balaban NQ, Merrin J, Chait R, Kowalik L, Leibler S. Bacterial persistence as a phenotypic switch. Science 2004;305:1622-5.  Back to cited text no. 58
    
59.
Torrey HL, Keren I, Via LE, Lee JS, Lewis K. High persister mutants in Mycobacterium tuberculosis. PLoS One 2016;11:e0155127.  Back to cited text no. 59
    
60.
Conlon BP, Rowe SE, Gandt AB, Nuxoll AS, Donegan NP, Zalis EA, et al. Persister formation in Staphylococcus aureus is associated with ATP depletion. Nat Microbiol 2016;1:16051.  Back to cited text no. 60
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed195    
    Printed3    
    Emailed0    
    PDF Downloaded48    
    Comments [Add]    

Recommend this journal