The International Journal of Mycobacteriology

ARTICLE
Year
: 2014  |  Volume : 3  |  Issue : 1  |  Page : 50--56

Comparison of an in-house multiplex PCR with two commercial immuno-chromatographic tests for rapid identification and differentiation of MTB from NTM isolates


Parveen Kumar, Prit Benny, Manisha Jain, Sarman Singh 
 Division of Clinical Microbiology $ Molecular Medicine, Department of Laboratory Medicine, All Institute of Medical Sciences, New Delhi 110029, India

Correspondence Address:
Sarman Singh
Division of Clinical Microbiology $ Molecular Medicine, Department of Laboratory Medicine, All India Institute of Medical Sciences, Ansari Nagar, New Delhi 110029
India

Abstract

Background: Species specific diagnosis of mycobacterial infection is crucial because treatment of infections caused by Mycobacterium tuberculosis (MTB) differs from that of non-tuberculous mycobacterial (NTM) species. The species identification used to be cumbersome and non-reproducible a decade ago. Objectives: Recently, some commercial tests have been made available to differentiate the MTB and NTM growths in culture media. Sensitivity and specificity of these tests was evaluated. Materials and methods: In this double blind study 572 clinical samples were cultured in an automated BACTEC-MGIT-960 system. A total of 147 (25.7%) samples were MGIT culture positive. These cultures were subjected to an in-house m-PCR (which amplifies hsp-65, esat-6 and ITS region for MAC), two commercial immune-chromatographic tests (ICTs) and phenotypic tests. Results: Of the 147 MGIT positive cultures, m-PCR was able to correctly identify MTB in 123 cultures and NTM in 24 which included 3 MAC isolates. m-PCR showed 100% agreement with two gold standard methods-the nitrate reductase assay and PNB tests-in correctly identifying MTB. Commercial strips were able to correctly identify MTB in 120 (97.5%) of 123 cultures, while 3 (2.5%) isolates were falsely identified as NTM. However, none of the growth negative spent medium gave false positive results in any of the tests. None of the commercial strips misidentified any of the 24 NTM as MTB; hence, specificity of these strips was 100%. Of the 2 IC test systems, both SD Bioline and BD TBc strip tests missed 2.5% of MTB isolates and misidentified these as NTM. Conclusion: The in-house m-PCR was found to be the most accurate and efficient tool for identifying the MTB, MAC and other NTMs.



How to cite this article:
Kumar P, Benny P, Jain M, Singh S. Comparison of an in-house multiplex PCR with two commercial immuno-chromatographic tests for rapid identification and differentiation of MTB from NTM isolates.Int J Mycobacteriol 2014;3:50-56


How to cite this URL:
Kumar P, Benny P, Jain M, Singh S. Comparison of an in-house multiplex PCR with two commercial immuno-chromatographic tests for rapid identification and differentiation of MTB from NTM isolates. Int J Mycobacteriol [serial online] 2014 [cited 2019 Sep 18 ];3:50-56
Available from: http://www.ijmyco.org/text.asp?2014/3/1/50/200927


Full Text



 Introduction



Early detection of tuberculosis (TB) is one of the key recommendations of the World Health Organisation Stop-TB strategy [1]. TB is mainly caused by Mycobacterium tuberculosis (MTB), but non-tuberculous Mycobacteria (NTM) can also cause similar manifestations, under certain conditions, such as if the host is immuno-compromised or if exposed to a very high dose of NTM species. More than 45 mycobacterial species are reported to be pathogenic or opportunistic pathogens to humans [2]. Despite similar clinical manifestations, the therapeutic regimen and course of treatment differ significantly for MTB and NTM. Therefore, accurate and timely species-specific diagnosis of mycobacterial infections becomes of paramount importance.

However, before identification of the species, it is important that it grows in vitro for further phenotypic tests. The conventional Lowenstein-Jensen (L-J) medium takes up to 60 days to grow MTB to a detectable level. Hence, in 2007, the World Health Organisation (WHO) recommended the use of an automated liquid culture system, i.e., BACTEC™ MGIT-960 (Mycobacterium Growth Indicator Tube 960 system) for rapid detection and drug susceptibility tests as a standard method for TB diagnosis [3]. However, the MGIT system does not provide information about the species grown. Hence, MGIT flashed positive cultures need to be further confirmed by Ziehl-Neelsen (Z-N) stained smear examination, whether the growth is mycobacterium or some contaminating bacterial growth [4], and then subculture is required on solid medium for colony characteristics. Mycobacterial species of the growth is confirmed by biochemical or molecular tests [5]. The differentiation of MTB from NTM can be achieved by conventional methods (growth rate, pigmentation of colonies and biochemical features), selective inhibition tests, such as para-nitro benzoic acid (PNB)/p-nitro-α-acetylamino-β-hydroxypropiophenone (NAP) and other commercial systems, recently introduced in the market. Although conventional biochemical methods are time-consuming, often requiring the use of hazardous/carcinogenic chemicals (e.g. niacin test), and are prone to subjective errors in the interpretation of results, these are considered the standard methods. Currently, rapid immuno-chromatographic tests (ICTs) have been developed that are based on a predominant protein MPT-64 secreted by M. tuberculosis, Mycobacterium africanum, and some strains of Mycobacterium bovis [6],[7],[8],[9]. ICTs provide quick results and hence WHO recommended use of ICTs for species identification in positive cultures [3].

In recent years, molecular techniques have made deep in-roads in TB diagnosis as they are highly sensitive, specific and can be applied directly on different types of samples as well as on grown cultures. Polymerase chain reaction (PCR)-based methods have also been used for rapid detection and differentiation of MTB and NTM [10]. However, monoplex PCRs are bound to miss the co-infections and solo infections with NTM. Therefore, in this study we used the standardized in-house multiplex PCR (m-PCR) for the rapid detection and differentiation of the M. tuberculosis, Mycobacterium avium complex (MAC) and other non-tubercular mycobacterial species in a single reaction [2],[11],[12].

In the present study, the efficacy of in-house m-PCR was evaluated and compared with two commercial ICTs: SD Bioline TB Ag MPT64 Rapid™ and BD MGIT TBc™ identification kits for their capabilities in differentiating MTB from NTM in MGIT cultures.

 Materials and methods



Data collected between January 2010 and December 2011 were analyzed retrospectively. All the samples which were submitted to the laboratory for mycobacterial culture and drug susceptibility testing as TB routine patient care service were included in the study. Hence, no ethical clearance was required for this study. However, all the study participants gave informed consent, as a standard diagnostic procedure of the laboratory, which is accredited by the central TB division of the Government of India and certified by the Stop-TB/WHO for non-commercial rapid culture and drug susceptibility tests [13].

Clinical specimens

In this study, a total of 572 clinical samples received from patients with suspected TB were cultured in an automated MGIT960 culture system. Of these, 125 were pulmonary specimens and 447 were extra-pulmonary specimens, which comprised of 123 CSF, 113 gastric aspirates, 49 pus, 55 pleural fluids, 30 peritoneal fluids, 27 tissue, 14 lymph node aspirates, 18 synovial fluids, 4 pericardial fluids and 14 ascitic fluids.

MGIT culture

Pulmonary and contaminated clinical specimens were decontaminated by using NALC–NaOH method in a biosafety cabinet, as described earlier [11]. The decontaminated specimens (no decontamination of clean specimens) were inoculated in the MGIT culture containing 800 μl of OADC and PANTA supplement as per the manufacturer's instructions (Becton Dickinson Diagnostic Instrument Systems, Sparks, MD, USA). The inoculated MGI tube was loaded in the automated BACTEC™ MGIT-960 system and the growth was continuously monitored by BD Epi-center®. From the flashed positive culture tubes, Z-N smear examination and ICTs were performed on the next working day. For this, 200 μl of suspension from MGIT culture was inoculated onto L-J medium for phenotypic testing, and a 500 μl suspension was aliquoted out for DNA extraction. All procedures were carried in a biosafety-level 2B cabinet.

DNA extraction from MGIT cultures

DNA isolation from the MGIT cultures was done as described elsewhere [11],[12],[14]. Briefly, the culture pellets from the 0.5 ml culture suspensions were lysed with lysozyme followed by proteinase-K-SDS treatment. Proteins and macromolecules were precipitated using NaCl and hexadecyltrimethylammonium bromide solutions. Nucleic acids were recovered from the aqueous phase after extraction with chloroform and iso-amyl alcohol followed by precipitation with 70% ice cold ethanol. The resulting DNA pellets were solubilised in 1× Tris–EDTA buffer and 5 μl were used for the multiplex PCR.

Multiplex PCR (m-PCR)

The in-house m-PCR was performed according to the patented protocol [15] as published previously [11],[12]. This m-PCR targets hsp-65 (genus specific), esat-6 (MTB specific) and internal transcribed spacer (ITS) MAC region (MAC specific). The sequences of primers were:

hsp-65 F- ACCAACGATGGTGTGTCCAT and

hsp-65 R- CTTGTCGAACCGCATACCCT;

esat-6 F- GCGGATCCCATGACAGAGCAGCAGTGGA and

esat-6 R- CCAAGCTTCCTATGCGAACATCCCAGTGACG;

ITS F- CCCTGA GACAACACTCGGTC and

ITS R- ATTACA CATTTCGATGAACGC.

PCR reaction was set up for 25 μl final volume and was run in a PTC-100 thermal cycler (MJ Research, USA) at the amplifying conditions of initial denaturation at 95°C for 10 min and 30 cycles of 95°C for 1 min, 59°C for 1 min and 72°C for 1 min and a final extension of 72°C for 10 min. Amplified products were resolved through 2% agarose gel in Tris–acetate buffer. Target bands of 441bp for the genus specific, 320bp for the M. tuberculosis and 144bp for M. avium complex were visualized by staining with ethidium-bromide. All mycobacterial species must amplify genus specific target and all MTB must amplify estat-6 region. If genus specific target is amplified but not the MTB or MAC specific, it indicates other NTM than MAC ([Figure 1]). The m-PCR results were blinded to the person who carried out the ICT.{Figure 1}

ICTs on mycobacterial culture

Two commercial assays, “BD MGIT™ TBc Identification Test” (Becton, Dickinson & Company, Sparks, MD, USA) [16] and “SD BIOLINE TB Ag MPT 64 Rapid™” (Standard Diagnostics, Inc., Korea) [17] were performed as per the manufacturer's instructions. Briefly, 100 μl of culture suspension from each MGIT tube was added in the sample well of both strips and allowed to flow up the pad; results were examined after 15 min for the presence of a pink band in “Control” and “Test” regions. The appearance of the control band confirmed the validity of the test. If the control band was not visible, the test was considered invalid and the sample was retested. The presence of the control band alone indicates a negative result. The presence of both control and test bands indicated a positive result, which was interpreted as the presence of MPT-64 antigen, i.e., MTB growth [18]. NTM culture is not detected by these strips. Ninety-one flashed negative cultures were also subjected to all three tests to check the specificity of each test.

Nitrate reductase assay

Nitrate reductase assay (NRA) was performed as a reference test to confirm if the growth was MTB or not [19]. Briefly, 2 loopful colonies of 21–28 days old culture were emulsified in 0.2 ml of distilled water in the screw-cap tube. Two milliliters of 0.01M sodium nitrate substrate buffer was added into the tube and placed in the water-bath at 37°C for 2 h. After that, the tubes were removed from the water bath and one drop of 50% hydrochloric acid solution, two drops of 0.2% sulfanilamide solution and two drops of 0.1% N-naphthyl ethylenediamine solution were added. The results were examined immediately by reading the color visually by comparing with the prescribed WHO color standards [20]. Only dark pink color readings between 3+ and 5+ were considered positive results for M. tuberculosis. In order to confirm the negative results, a small amount of zinc powder was added to each negative tube that should not develop any color to confirm the test result as being truly negative.

Para-nitro benzoic acid test (PNB)

All the culture isolates that showed negative results by both ICTs and identified as Mycobacterium sp by PCR were further subjected to the PNB test. The PNB was incorporated into the L-J medium at a final concentration of 500 μg/ml which inhibits the growth of MTB [21]. Medium without any inhibitory substance was considered as growth control. Five microliters of McFarland 1 inoculum suspension was inoculated onto the PNB and plain media and incubated at 37°C for 28 days.

Statistical analysis

The m-PCR results were analyzed and compared with ICT, NRA and PNB assay as standard. The data were statically analyzed to calculate the sensitivity, specificity, Positive Predictive Value (PPV) and Negative Predictive Value (NPV).

 Results



Out of 572 specimens, 147 were MGIT cultures flashed positive and 425 were MGIT culture negative for Mycobacterium sp ([Figure 2]). All flashed positive and negative cultures were checked for acid fast bacilli by Z-N stained smear examination (X1000) as per standard criteria. Of the 147 MGIT culture positive growths, 52 mycobacterial cultures were from pulmonary specimens and 95 from extra-pulmonary specimens as shown in [Table 1]. From 425 flashed negative (spent) cultures (after 42 days of incubation), at least 5 samples were also selected randomly on the day of experimentation to check the specificity of each test. {Table 1}{Figure 2}

Multiplex-PCR was tested on 238 MGIT cultures, of which 147 were MGIT culture positive. Out of 147 positive cultures, m-PCR detected all (100%) as mycobacterial growth-123 (83.67%) cultures as MTB, 21 (14.28%) other NTM, and 3 (2%) as MAC. All 91 MGIT negative cultures were negative by m-PCR ([Figure 1], [Table 1]). In the strip test, all results were valid as indicated by the presence of a control band (C band). No significant difference was observed in band intensity in two strip tests. Out of 147 MGIT positive cultures, 120 (81.5%) cultures were positive for MTB and 27 (18.45%) negative by both SD Bioline ICT and BD ICT strips ([Table 1] and [Table 2]). Hence both strips had the same sensitivity and specificity.{Table 2}

Most notable performance of m-PCR was on 27 strip negative but MGIT and smear positive cultures. Of these, 3 (10.1%) were detected as MTB, 21 (77.7%) as other NTM and 3 (10.1%) as MAC. Of the 91 MGIT negative cultures, all were found negative by both ICT strip tests as well. Hence, the sensitivity and specificity rates of ICT kits were 97.5% and 100% respectively, as compared with m-PCR ([Table 3]).{Table 3}

NRA test and PNB test were used as standard methods. All 123 cultures that identified MTB in m-PCR showed positive nitrate reduction test and identified these cultures as true MTB. All 24 mycobacterial isolates that were identified as NTM (21) and MAC (3) by m-PCR showed negative reaction in nitrate tests ([Table 1] and [Table 2]).

Culture isolates that showed negative results by both the ICTs and were identified as Mycobacterium by PCR were further evaluated by a PNB test. Out of 27 ICTs negative, 24 isolates were resistant and 3 isolates were sensitive to PNB. Thus, these 3 isolates were truly detected as MTB by m-PCR, while misidentified by both the ICTs ([Table 1] and [Table 2]). Hence, the sensitivity and specificity of the m-PCR was 100% when compared with the nitrate and PNB tests ([Table 3]). An excellent agreement (Cohen's kappa κ= 1) was observed among m-PCR, nitrate and PNB test for MTB detection.

Discussion

Recently, WHO estimated 8.7 million incident cases of TB and 1.4 million deaths occurred due to TB worldwide in 2011 [22]. Beside MTB infections, a significant percentage of patients are infected by NTM, especially those co-infected with HIV [2],[23]. Clinically, the symptoms of disease caused by NTM are often similar to MTB disease. These patients are empirically prescribed with standard anti-TB drugs which are inherently ineffective against these NTM and most often these cases are labeled MDR on the basis of smear examination. It is mainly because in most of the resource-limited countries where TB is endemic, facilities for species-specific identification of the causative agent are lacking [24]. The treatment of infections caused by NTM species and MTB is entirely different. Though some NTM can be treated with simple antibiotics in a few days, but for that correct species has to be identified in order to initiate the appropriate treatment [25].

Mycobacterial growth on conventional L-J medium is fairly identifiable if the growth is MTB. Rapid growers, photochromogenic and scotochromogenic mycobacteria can also be identified without much difficulty [19]. However, liquid cultures have this limitation, though these provide a faster diagnosis of TB. Hence after inclusion of liquid cultures in most of the national TB control programmes, a number of ICT assays have been developed to resolve this limitation. Most of these are based on the presence of MPT-64 and/or MPT-63 antigens in MTB, but not in NTM. The widely used commercial tests for this purpose are Capilia TB assay (Tauns Laboratories, Inc., Numazu, Japan), the Tibilia rapid test (Hangzhou, China), the SD Bioline TB Ag MPT64 rapid test (Standard Diagnostics, South Korea), and the BD MGIT TBc identification test. MPT-64 protein was first used for rapid detection of MTB by the researchers in Japan which showed excellent specificity and sensitivity [4],[5],[10],[26],[27],[28],[29],[30].

However, these tests can be applied only after a significant growth has taken place in the medium which takes several days to weeks. To minimize this duration, several nucleic acid amplification assays (NAAT) have been developed, which are already commercialized or undergoing clinical evaluation. Centers for Disease Control and Prevention (CDC) and the American Thoracic Society (ATS) recommend well standardized NAAT to be performed for rapid screening of patients with signs and symptoms of pulmonary TB [31],[32]. Even though these monoplex NAATs are well accepted, they are bound to miss the co-infections and infections with NTM. To overcome this limitation, an in-house m-PCR was developed which provides rapid detection and differentiation of the M. tuberculosis, M. avium complex and other NTM species in a single reaction tube [11],[12],[15].

The present study demonstrated the superiority of the in-house multiplex-PCR in comparison with two commercial ICT assays: BD MGIT™ TBc identification and SD Bioline TB AgMPT64 rapid strip tests, in terms of species specific identification of mycobacteria. When compared with standard and reference phenotypic assays, the in-house m-PCR showed 100% sensitivity and specificity in MTB detection. However, the two commercial strips could achieve only 97.5% sensitivity. Three isolates identified as MTB by m-PCR were missed by both ICT tests. All three isolates were identified as MTB by NRA and PNB tests as well. Thus, m-PCR was able to detect MTB truly in all cases. The in-house m-PCR amplifies the novel target esat-6 of the MTB which belongs to a cluster of five genes in the region of differentiation-1 (RD1). This gene is conserved only in M. tuberculosis complex species, Mycobacterium kansasii and Mycobacterium marinum and is deleted from most NTM species including M. bovis (BCG) strains. Therefore, even though there is a possibility of false positive m-PCR (if M. marinum or M. kansasii is present in the sample), these false positive amplifications can be easily differentiated from MTB specific amplification. The MTB complex will give a single clear band while M. kansasii will show a pair of bands [23].

False negative results by strip test have also been reported due to mutations [33],[34], deletions [6],[33], and IS6110/CG insertions [33],[34],[35] in the coding region [6] of the mpt-64 gene. The most frequent mutation reported was a 63-bp deletion at position 196 in 10 isolates from Japan, Taiwan, and Thailand and was later identified at species level [36]. It has been reported that insertion in the mpt-64 gene in the nucleotide position 324, 108 codon, changing the primary structure of half protein and introducing an end signal (TGA) at nucleotide 498, codon 167 in the reading frame [5].

The results of the present study show that both SD Bioline TB Ag MPT64 RAPID and BD MGITTM TBc identification tests show identical performance, but both have lower sensitivity missing at least ˜3 MTB isolates. In contrast our in-house m-PCR was found to be more sensitive than these commercial ICT strips. It was rapid in identifying and differentiating MTB complex, MAC and other NTM in liquid as well as solid cultures. The m-PCR showed 100% sensitivity, specificity and agreement with phenotypic reference tests.

 Author contribution



PK carried out the experiment and drafted the manuscript; PB & MJ carried out the experiments; SS conceptualized the study and arranged reagents and funds for carrying out the study.

 Competing interests



The authors declare that they have no competing interests.

 Acknowledgment



We wish to thank Mr. Satyendra Kumar Sahani, Brijesh Kumar and Virendra Kapil for their technical help. This study was partially supported by a Grant from the Department of Biotechnology, Govt of India (BT/PR7761/MED/14/1105/2006) to SS.

References

1Stop TB Partnership, World Health Organization. The global plan to stop TB 2011–2015: transforming the fight towards elimination of tuberculosis. WHO/HTM/STB/2010.2, Geneva, Stop TB Partnership, 2010.
2K. Gopinath, S. Singh, Non-tuberculous mycobacteria in TBendemic countries: are we neglecting the danger?, PLoS Negl Trop. Dis. 4 (2010) e615.
3World Health Organization. Use of Liquid TB Culture and Drug Susceptibility Testing (DST) in Low and Medium Income Settings. Summary Report of the Expert Group Meeting on the Use of Liquid Culture Media, WHO, Geneva, Switzerland, 2007.
4A. Martin, D. Bombeeck, K. Fissette, P. de Rijk, I. Hernández- Neuta, P. Del Portillo, et al, Evaluation of the BD MGIT TBc Identification Test (TBc ID), a rapid chromatographic immunoassay for the detection of Mycobacterium tuberculosis complex from liquid culture, J. Microbiol. Methods 84 (2011) 255–257.
5A.S. Barouni, Z.B. Alnajh, N.B. Aboguttaia, W.M. Alamri, Evaluation of the BD MGIT TBc identification test for rapid identification of Mycobacterium tuberculosis Complex from positive BACTEC MGIT 960 cultures in a routine laboratory work, Afr. J. Microbiol. Res. 6 (2012) 1065–1068.
6S. Nagai, H.G. Wiker, M. Harboe, M. Kinomoto, Isolation and partial characterization of major protein antigens in the culture fluid of Mycobacterium tuberculosis, Infect. Immun. 59 (1991) 372–382.
7C. Abe, K. Hirano, T. Tomiyama, Simple and rapid identification of the Mycobacterium tuberculosis complex by immuno-chromatographic assay using anti-MPB 64 monoclonal antibodies, J. Clin. Microbiol. 37 (1999) 3693–3697.
8J.R. Reddy, J. Kwang, K.F. Lechtenberg, N.C. Khan, R.B. Prasad, M.M. Chengappa, An immunochromatographic serological assay for the diagnosis of Mycobacterium tuberculosis, Comp. Immunol. Microbiol. Infect. Dis. 25 (2002) 21–27.
9N. Hasegawa, T. Miura, K. Ishii, K. Yamaguchi, T.H. Lindner, S. Merritt, et al, New simple and rapid test for culture confirmation of Mycobacterium tuberculosis complex: a multicenter study, J. Clin. Microbiol. 40 (2002) 908–912.
10K.S. Nabin, J.T. Marion, S.H. Gerri, U. Reischl, S.M. Gordon, G.W. Procop, Detection and differentiation of Mycobacterium tuberculosis and nontuberculous mycobacterial isolates by real-time PCR, J. Clin. Microbiol. 41 (2003) 5121–5126.
11K. Gopinath, S. Singh, Multiplex PCR assay for simultaneous detection and differentiation of Mycobacterium tuberculosis, Mycobacterium avium complexes and other mycobacterial species directly from clinical specimens, J. App. Microbiol. 107 (2009) 1364–1372.
12M.M. Sankar, P. Kumar, A. Munawwar, M. Kumar, J. Singh, A. Singh, et al, Usefulness of multiplex PCR in the diagnosis of genital tuberculosis in females with infertility, Eur. J. Clin. Microbiol. Infect. Dis. 32 (2013) 399–405.
13S. Singh, P.Kumar, S. Sharma, F.Mumbowa,A.Martin,N.Durier, Rapid Identification and Drug Susceptibility Testing of Mycobacteriumtuberculosis: StandardOperating Procedure for Non-Commercial Assays: Part 1: Microscopic Observation Drug Susceptibility Assay v2.4.12, J. Lab. Physicians 4 (2012) 101–111.
14D. van Soolingen, P.W. Hermans, P.E. de Haas, D.R. Soll, J.D. van Embden, Occurrence and stability of insertion sequences in Mycobacterium tuberculosis complex strains: evaluation of an insertion sequence-dependent DNA polymorphism as a tool in the epidemiology of tuberculosis, J. Clin. Microbiol. 29 (1991) 2578–2586.
15S. Singh, P. Sharma. Methods for detection of Mycobacterium tuberculosis, European patent no. 1711620. 2009.
16BD MGITTM TBc identification test. Available from: http:// www.bd.com/resource.aspx?IDX=11376.
17TB Antigen MPT 64 Rapid. Company catalogue. Available from: http://www.standardia.com/html_e/mn03/ mn03_01_00.asp?intId=99.
18A.K. Maurya, V.L. Nag, S. Kant, R.A.S. Kushwaha, M. Kumar, V. Mishra, et al, Evaluation of an immune-chromatographic test for discrimination between Mycobacterium tuberculosis complex & non tuberculous mycobacteria in clinical isolates from extra-pulmonary tuberculosis, Indian J. Med. Res. 135 (2012) 901–906.
19P.T. Kent, G.P. Kubica. Public Health Mycobacteriology: A Guide for the Level III Laboratory, US Department of Health and Human Services, Centres for Disease Control and Prevention, Atlanta, Georgia, USA, 1985.
20World Health Organization, Laboratory services in TB control. Part III: culture, WHO, Geneva, 1998. WHO/TB/98.258. Available from: http://www.who.int/tb/dots/laboratory/ resources.
21C.M. Giampaglia, M.C. Martins, E. Chimara, R.S. Oliveira, G.B. de Oliveira Vieira, A.G. Marsico, et al, Differentiation of Mycobacterium tuberculosis from other mycobacteria with pnitrobenzoic acid using MGIT 960, Int. J. Tuberc. Lung Dis. 11 (2007) 803–807.
22World Health Organisation. Global Tuberculosis Control Report WHO Report 2012, WHO/HTM/TB/2012.6, WHO, Geneva, Switzerland, 2012.
23S. Singh, K. Gopinath, S. Shahdad, M. Kaur, B. Singh, P. Sharma, Non-tuberculous mycobacterial infections in Indian AIDS patients detected by a novel set of ESAT-6 polymerase chain reaction primers, Jpn. J. Infect. Dis. 60 (2007) 14–18.
24S. Singh, Scaling up anti-mycobacterial drug susceptibility testing services in India: it is high time, Indian J. Med. Microbiol. 26 (2008) 209.
25M.M. Sankar, K. Gopinath, R. Singla, S. Singh, In-vitro antimycobacterial drug susceptibility testing of nontubercular mycobacteria by tetrazolium microplate assay, Ann. Clin. Microbiol. Antimicrob. 7 (2008) 7–15.
26J.Y. Wang, L.N. Lee, H.C. Lai, H.L. Hsu, I.S. Jan, C.J. Yu, et al, Performance assessment of the Capilia TB assay and the BD ProbeTec ET system for rapid culture confirmation of Mycobacterium tuberculosis, Diagn. Microbiol. Infect. Dis. 59 (2007) 395–399.
27M.Y. Park, Y.J. Kim, S.H. Hwang, H.H. Kim, E.Y. Lee, S.H. Jeong, et al, Evaluation of an immuno-chromatographic assay kit for rapid identification of Mycobacterium tuberculosis complex in clinical isolates, J. Clin. Microbiol. 47 (2009) 481–484.
28Y.F. Ngeow, Y.L. Wong, K.P. Ng, C.S. Ong, W.W. Aung, Rapid, cost-effective application of Tibilia TB rapid test for culture confirmation of live and heat-killed Mycobacterium tuberculosis, J. Clin. Microbiol. 49 (2011) 2776–2777.
29M.C. Yu, H.Y. Chen, M.H. Wu, W.L. Huang, Y.M. Kuo, F.L. Yu, et al, Evaluation of the rapid MGIT TBc identification test for culture confirmation of Mycobacterium tuberculosis complex strain detection, J. Clin. Microbiol. 49 (2011) 802–807.
30T. Gaillard, M. Fabre, C. Martinaud, R. Vong, P. Brisou, C. Soler, Assessment of the SD Bioline Ag MPT64 RapidTM and the MGITTM TBc identification tests for the diagnosis of tuberculosis, Diagn. Microbiol. Infect. Dis. 70 (2011) 154–156.
31American Thoracic Society Documents, American Thoracic Society/Centers for Disease Control and Prevention/ Infectious Diseases Society of America: Controlling Tuberculosis in the United States, Am. J. Respir. Crit. Care. Med. 172 (2005) 1169–1227.
32Centers for Disease Control and Prevention, Updated guidelines for the use of nucleic acid amplification tests in the diagnosis of tuberculosis, MMWR 58 (2009) 7–10.
33K. Hirano, A. Aono, M. Takahashi, C. Abe, Mutations including IS6110 insertion in the gene encoding the MPB64 protein of Capilia TB negative Mycobacterium tuberculosis isolates, J. Clin. Microbiol. 42 (2004) 390–392.
34D. Hillemann, S. Rusch-Gerdes, E. Richter, Application of the Capilia TB assay for culture confirmation of Mycobacterium tuberculosis complex isolates, Int. J. Tuberc. Lung Dis. 9 (2005) 1409–1411.
35M. Muyoyeta, P.E.W. de Haas, D.H. Muelleret, Evaluation of the Capilia TB assay for culture confirmation of Mycobacterium tuberculosis in Zambia and South Africa, J. Clin. Microbiol. 48 (2010) 3773–3775.
36J.B. Andrew, M. Daisy, M. Robert, A. Mutiso, S. Morpeth, M. Levin, et al, Performance of the MGIT TBc identification test and meta-analysis of MPT64 assays for identification of the Mycobacterium tuberculosis complex in liquid culture, J. Clin. Microbiol. 49 (2011) 4343–4346.