The International Journal of Mycobacteriology

ORIGINAL RESEARCH ARTICLE
Year
: 2017  |  Volume : 6  |  Issue : 1  |  Page : 97--101

Association between pulmonary tuberculosis and Type 2 diabetes in Sudanese patients


Mona Ahmed1, Ibtihal Omer1, Sannaa M. A Osman2, Eltayib H Ahmed-Abakur2,  
1 Department of Molecular Biology, National Ribat University Teaching Hospital, Khartoum, Sudan
2 Department of Microbiology, Alzaiem Alazhari University, Khartoum, Sudan

Correspondence Address:
Ibtihal Omer
Molecular Biology Unit, National Ribat University Teaching Hospital, Khartoum
Sudan

Abstract

Introduction: Tuberculosis (TB) and diabetes mellitus (DM) are both important health issues, and the association between DM and TB may be the next challenge for global TB control worldwide, type 2 DM (T2DM) responsible for 90% of DM cases. Persons with diabetes have a significantly increased risk of active TB, which is two to three times higher than in persons without diabetes. The aim of this study was to determine the association between pulmonary tuberculosis (PTB) and T2DM among Sudanese patients and also to determine the association between hemoglobin A1c (HbA1c) percentage in diabetic patients and development of PTB and effect of duration of T2DM in developing PTB. Materials and Methods: A total of 120 sputum samples were collected from patients during 6 months in Ribat University Hospital, Khartoum, Sudan. Sixty of them were known type 2 diabetic patients categorized as study group and sixty were nondiabetic patients categorized as control group. Ziehl–Neelsen smear preparation and DNA were extracted from sputum for detection of Mycobacterium tuberculosis by polymerase chain reaction (PCR). Results: Among the 120 sputum specimens, 72 (60%) were males and 48 (40%) were females. Fourteen (19.4%) males and 6 (12.5%) females had PTB, the difference was not statistically significant according to gender P = 0.229. According to treatment modalities, diabetic patients were treated with injectable insulin (36.7%), PCR positive was 4(33.3%) P value (0.853), oral hypoglycemic drugs (51.7%) PCR positive 7 (58.3%) P value (0.849) and dietary control (11.7%) PCR positive (1 (8.3%) P value (1.000) Were insignificant differences. The frequency of HbA1c of 58 patients with diabetes was 24 (41.4%) who had controlled DM (HbA1c level ≤ 6.5%) and 34 (58.6%) had uncontrolled DM. Of the 60 patients with diabetes, 12 had PTB with uncontrolled DM, with significant difference (P=0.000). The mean duration of diabetes mellitus was (6.92 years ± Std 6.801) and the frequency of diabetes mellitus in first 10 years was 47 (78.3%), in (11-20) years was 10 (16.7%) and in (21-30) years was 3 (5%), the PCR positive PTB showed 10(21.3%) for the first 10 years, (11-20) years was 2 (20%) and zero (0.0%) for (21-30) years, P-value (0.480) insignificant different. Conclusions: In summary, we found consistent evidence for an increased risk of TB among patients with uncontrolled DM (high-level HbA1c).



How to cite this article:
Ahmed M, Omer I, Osman SM, Ahmed-Abakur EH. Association between pulmonary tuberculosis and Type 2 diabetes in Sudanese patients.Int J Mycobacteriol 2017;6:97-101


How to cite this URL:
Ahmed M, Omer I, Osman SM, Ahmed-Abakur EH. Association between pulmonary tuberculosis and Type 2 diabetes in Sudanese patients. Int J Mycobacteriol [serial online] 2017 [cited 2019 Aug 25 ];6:97-101
Available from: http://www.ijmyco.org/text.asp?2017/6/1/97/201887


Full Text

 Introduction



Tuberculosis (TB) remains a major source of morbidity and mortality throughout the world.[1],[2] One-third of the world's population is estimated to be infected with Mycobacterium tuberculosis (MTB), whereby approximately 9 million people develop the disease each year, and almost 2 million of populations die annually as a result of TB.[3] According to the World Health Organization, there are over 347 million people in the world suffering from diabetes mellitus (DM).[4] Projections indicate that by 2030 DM will become the seventh leading cause of death worldwide, and type 2 DM (T2DM) will be responsible for 90% of DM cases.[5] Persons with diabetes have a significantly increased risk of active TB, which is two to three times higher than in persons without diabetes.[6],[7] People with diabetes also suffer from a number of pulmonary physiologic abnormalities including diminished bronchial reactivity.[8],[9] Abnormalities in the pulmonary physiologic functions lead to delayed clearance of microorganisms from the respiratory system and facilitate the spread of infections in the host [10] which is also due to their immunocompromised status with reactivation of older foci of TB rather than through fresh contact and often exhibit lower lobe involvement more commonly than in persons without diabetes.[11]

The aim of the present study was to determine the association between PTB and T2DM among Sudanese patients and also to determine the association between hemoglobin A1c (HbA1c) percentage in patients with diabetes and developing pulmonary TB (PTB) and effect of duration of T2DM in developing PTB.

 Materials and Methods



This is a case–control study conducted in a total of 120 sputum samples collected from patients during 6 months in Ribat University Hospital, Khartoum, Sudan. Sixty of them were known type 2 diabetic patients categorized as study group and sixty were nondiabetic patients categorized as control group.

Basic information of the patients was collected by a questionnaire including age, sex, socioeconomic status, duration of diabetes, type of treatment, and HbA1c%.

Ziehl–Neelsen (ZN) smear preparation, fixation, and staining were done according to Monica Cheesbrough [12]

Molecular biology processing

Sputum preparation for DNA extraction

Equal volumes of specimen and NaOH 4% (decontamination and homogenization reagent) were added to the sample. Finally, the solution was homogenized by vortexing the tube.

DNA extraction

Genomic DNA was extracted from sputum by using Cinna Pure™ DNA kit, according to manufacturer's instructions. MTB gene was detected by polymerase chain reaction (PCR) using two primers from published data [13] as follows: F: CCTCCGAGCGTAGGCGTCGG, R: CTCGTCCAGCGCCGCTTCGG. The primers amplify and detect an Is6110 gene (123 bp) with 25 μl of reaction mixture containing 5 μl DNA sample, 5 μl Maxime PCR PreMix Kit (i-Taq) (iNtRON Biotechnology Inc., Korea), 1 μl of each forward and reverse primer, and 13 μl nuclease-free water. The conditions for PCR analyses were as follows: Incubation at 94°C for 5 min, followed by 30 cycles at 94°C for 1 min, 67.5°C for 1 min, 72°C for 1 min, and end (1 cycle) at 72°C for 7 min. After the last cycle, the samples were incubated at 72°C for 10 min. PCR products were analyzed by electrophoresis in a 2% agarose gel and observed under UV transillumination.

Data analysis

Data were analyzed using computerized program Statistical Package for (SPSS) software (version 16, SPSS, Inc, Chicago, IL, USA)., namely Chi-square and cross tabulation.

 Results



A total of 120 sputum samples were collected from patients during 6 months, sixty of them were known type 2 diabetic patients categorized as study group and sixty were nondiabetic patients categorized as control group. Seventy-two (60%) were males and 48 (40%) were females. Fourteen (19.4%) males and 6 (12.5%) females had PTB, the difference was not statistically significant according to gender (P = 0.229).

The results of sputum smears of ZN staining were positive in 15 (12.5%) in comparison with 20 (16.7%) positive by PCR and 100 (83.3%) negative by PCR [Figure 1], which showed statistically significant difference (P = 0.000) [Table 1].{Figure 1}{Table 1}

In the study group (diabetic group), PCR positive was 12 (20%) higher than control group (nondiabetic group) which was 8 (13.3%), which was insignificantly different (P = 0.232) [Table 2].{Table 2}

The frequency of HbA1c of 58 diabetic patients was 24 (41.4%) with controlled DM (HbA1c level ≤ 6.5%) and 34 (58.6%) with uncontrolled DM. Of the 60 patients with diabetes, 12 had PTB with uncontrolled DM, which shows statistically significant difference (P = 0.000) [Table 2].

The mean duration of diabetes mellitus was (6.92 years ± Std 6.801) and the frequency of diabetes mellitus in first 10 years was 47 (78.3%), in (11-20) years was 10 (16.7%) and in (21-30) years was 3 (5%), the PCR positive PTB showed 10 (21.3%) for the first 10 years, (11-20) years was 2 (20%) and zero (0.0%) for (21-30) years, P-value (0.480) insignificant different [Table 2].

According to treatment modalities, in the study group (diabetic patients), 22/60 (36.7%) of them were treated with injectable insulin, PCR positive was 4 (33.3%) P value (0.853). 31/60 (51.7%) received oral hypoglycemic drugs, PCR positive 7 (58.3%) P value (0.849) and 7/60 (11.7%) had dietary control, PCR positive 1 (8.3%) P value (1.000) was insignificant differences [Table 2].

When the frequency according to socioeconomic status was concerned, PTB was found in low socioeconomic class (19.2%), moderate (16.9%), and high (25%), which showed insignificant difference (P = 0.956) [Table 2].

The mean age of patients in this study was 46 years ± 16, and the most frequent age group was (50–59) years' (26.7%), the distribution of PTB among age group in non diabetic was higher in age group (20–29 years) which was 4 (50%) PCR positive, while diabetic group showed higher PTB in age group (50–59 years) where was 4 (33.3%) PCR positive [Table 3].{Table 3}

 Discussion



More than 8 million of people develop active PTB all over the world, and 2 million die because of this highly contagious infection. It is said that about one third of the world's population is infected with MTB, but not all of those infected develop active TB because the immune system controls the infection.[14] However, in some people, the bacteria can remain dormant for years and could become active disease at a later stage, especially in those with risk factors such as old age, diabetes, those on immunosuppressive treatments, and patients with HIV.[15]

Despite the control strategies, TB remains a major health problem in Sudan. While DM is a known risk factor for TB, no studies have been conducted in Sudan on TB in type 2 diabetic patients, and the exact prevalence of TB in this group of patients is still unknown.

PCR is an alternative method for diagnosis of PTB [16],[17] besides the culture and ZN stain, with the advantage of a rapid and simultaneous identification of MTB, but with the disadvantage of a higher cost [18] while ZN is cheap and easy to perform but its low sensitivity is a major drawback.[19]

PCR technique can still be advantageous when compared with conventional methods for the rapid diagnosis of TB. This technique can reduce the diagnosis time and may increase the detection of mycobacteria in smear negative TB, and that is approved in our study whereas PCR positive result of PTB showed 16.7% which was higher than 12.5% of positive result by ZN smear.

This study showed that PTB among DM group was higher than in nondiabetic patients; 12 (20%) and 8 (13.3%) respectively, among the total population, 12 (60%) patients who got PTB infection belong to DM group. This result indicates that DM is associated with PTB infection although the statistical analysis showed insignificant relation (P = 0.232). However, several other studies showed a significant association.[5],[20],[21] These variations may attribute to the sample size, type of DM, or duration of DM and study duration.

This study showed insignificant difference with diabetes treatment and PTB, while in another study in Ethiopia, it was found that the risk of developing TB among insulin-dependent patients with diabetes and noninsulin-dependent diabetic patients was 26 times and seven times, respectively, that of the general population.[22]

This study showed an association between PTB and uncontrolled diabetic patients with high level of HbA1c, which is statistically significant (P = 0.000), similar result was found in other studies.[23],[24]

Patients with DM duration of 1–10 years showed higher incidence of PTB, other studies showed increase of duration significant with higher prevalence of PTB.[25] According to Bokam and Pujitha Thota,[26] increase of HbA1c with increase in duration of diabetes may be due to that the patients do not know they have diabetes and the infection itself may be the cause for higher HbA1c. In addition, some investigators suggested that the association reflects the effect of DM on TB, some controversy over the directionality of the association remains due to observations that TB disease induces temporary hyperglycemia, which resolves with treatment.[27]

Our study has the following limitation; our database does not include differences in the outcome of TB treatment in patients with and without DM.

Data from human studies are consistent with emerging information on the biological mechanisms by which hyperglycemia may affect the host immune response to TB. Our findings suggest that TB control programs should consider targeting patients with diabetes for interventions such as active case finding and the treatment of latent TB; diagnosing, detecting, and treating DM may have a beneficial impact on TB control.

 Conclusion



We found consistent evidence for an increased risk of TB among patients with uncontrolled DM (high-level HbA1c) in Sudanese population.

Recommendation

Based on our results, we recommend that:

Negative results of ZN smears should be confirmed by PCRPatients with diabetes should follow up the level of blood glucose to avoid the complicationScreening of TB among patients with diabetes and screening of diabetes among patients with TBSurveillance is needed in our country to demonstrate the prevalence of DM in patients with TBDifferentiation between Type I diabetic patients versus Type II diabetic patients in their association with TBThe outcome of TB treatment in patients with and without DMWe also recommend further studies investigating how TB risk varies by type, duration, and severity of DM, for a more thorough understanding of the association that could be translated into a clear public health message.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

References

1Zaman K. Tuberculosis: A global health problem. J Health Popul Nutr 2010;28:111-3.
2Connell DW, Berry M, Cooke G, Kon OM. Update on tuberculosis: TB in the early 21st century. Eur Respir Rev 2011;20:71-84.
3García-Elorriaga, Rey-Pineda D. Type 2 diabetes mellitus as a risk factor for tuberculosis. Journal of Mycobacterial Disease 2014;4:2.
4Reis-Santos B, Locatelli R, Horta BL, Faerstein E, Sanchez MN, Riley LW, et al. Socio-demographic and clinical differences in subjects with tuberculosis with and without diabetes mellitus in Brazil – A multivariate analysis. PLoS One 2013;8:e62604.
5Pérez-Navarro LM, Fuentes-Domínguez FJ, Zenteno-Cuevas R. Type 2 diabetes mellitus and its influence in the development of multidrug resistance tuberculosis in patients from Southeastern Mexico. J Diabetes Complications 2015;29:77-82.
6Harries AD, Lin Y, Satyanarayana S, Lönnroth K, Li L, Wilson N, et al. The looming epidemic of diabetes-associated tuberculosis: learning lessons from HIV-associated tuberculosis. Int J Tuberc Lung Dis 2011;15:1436-44.
7Harries AD, Satyanarayana S, Kumar AM, Nagaraja SB, Isaakidis P, Malhotra S, et al. Epidemiology and interaction of diabetes mellitus and tuberculosis and challenges for care: A review. Public Health Action 2013;3 Suppl 1:S3-9.
8Irfan M, Jabbar A, Haque AS, Awan S, Hussain SF. Pulmonary functions in patients with diabetes mellitus. Lung India 2011;28:89-92.
9Olayinka AO, Anthonia O, Yetunde K. Prevalence of diabetes mellitus in persons with tuberculosis in a tertiary health centre in Lagos, Nigeria. Indian J Endocrinol Metab 2013;17:486-9.
10Siddiqui A. Role of diabetes in prevalence of tuberculosis. J Diabetes Metab 2011;2:1-6.
11Niazi AK, Kalra S. Diabetes and tuberculosis: A review of the role of optimal glycemic control. J Diabetes Metab Disord 2012 20;11:28.
12Cheesbrough M. District Laboratory Practice in Tropical Countries, New York, Cambridge University Press, Second Edition; 2006. p. 34-6.
13Osman AL, Saeed NS, Elhassan MM. Polymerase chain reaction targeting insertion sequence IS6110 for the diagnosis of pulmonary tuberculosis among Sudanese children and young adults. Int J Mycobacteriol 2014;3:252-8.
14du Toit LC, Pillay V, Danckwerts MP. Tuberculosis chemotherapy: Current drug delivery approaches. Respir Res 2006;7:118.
15Chaudhry LA, Essa EB, Al-Solaiman S, Al-Sindi K. Prevalence of diabetes type-2 and pulmonary tuberculosis among Filipino and treatment outcomes: A surveillance study in the Eastern Saudi Arabia. Int J Mycobacteriol 2012;1:106-9.
16Hasan MM, Hossain MA, Paul SK, Mahmud C, Khan ER, Rahman MM, et al. Evaluation of PCR with culture for the diagnosis of pulmonary tuberculosis. Mymensingh Med J 2012;21:399-403.
17da Silva RM, Machado T, Bazzo ML. Diagnosis of the pulmonary tuberculosis by polymerase chain reaction: A comparative study between HIV-positive and –Negative individuals. Braz J Microbiol 2012;43:261-5.
18Lima SS, Clemente WT, Palaci M, Rosa RV, Antunes CM, Serufo JC. Conventional and molecular techniques in the diagnosis of pulmonary tuberculosis: A comparative study. J Bras Pneumol 2008;34:1056-62.
19Kivihya-Ndugga L, van Cleeff M, Juma E, Kimwomi J, Githui W, Oskam L, et al. Comparison of PCR with the routine procedure for diagnosis of tuberculosis in a population with high prevalences of tuberculosis and human immunodeficiency virus. J Clin Microbiol 2004;42:1012-5.
20Pérez A, Brown HS 3rd, Restrepo BI. Association between tuberculosis and diabetes in the Mexican border and non-border regions of Texas. Am J Trop Med Hyg 2006;74:604-11.
21Kibirige D, Ssekitoleko R, Mutebi E, Worodria W. Overt diabetes mellitus among newly diagnosed Ugandan tuberculosis patients: A cross sectional study. BMC Infect Dis 2013;13:122.
22Feleke Y, Abdulkadir J, Aderaye G. Prevalence and clinical features of tuberculosis in Ethiopian diabetic patients. East Afr Med J 1999;76:361-4.
23Leung CC, Lam TH, Chan WM, Yew WW, Ho KS, Leung GM, et al. Diabetic control and risk of tuberculosis: A cohort study. Am J Epidemiol 2008;167:1486-94.
24Webb EA, Hesseling AC, Schaaf HS, Gie RP, Lombard CJ, Spitaels A, et al. High prevalence of Mycobacterium tuberculosis infection and disease in children and adolescents with type 1 diabetes mellitus. Int J Tuberc Lung Dis 2009;13:868-74.
25Jabbar A, Hussain SF, Khan AA. Clinical characteristics of pulmonary tuberculosis in adult Pakistani patients with co-existing diabetes mellitus. East Mediterr Health J 2006;12:522-7.
26Bokam BR, Thota P. Effect of glycemic control on pulmonary tuberculous. Indian J Basic Appl Med Res 2016;5:198-207.
27Al-Muhana S, Al-Karawi MI, Attaa K, Razak AH. Treatment failure of tuberculosis in diabetic patients. Karbala Journal of medical 2009;2:630-4.