The International Journal of Mycobacteriology

ORIGINAL ARTICLE
Year
: 2020  |  Volume : 9  |  Issue : 1  |  Page : 1--6

Prevalence of paratuberculosis in dairy cattle in ecuador


Gustavo Echeverr1, Henry Escobar2, Darwin Changoluisa3, Lenin Ron2, Andrea Proaño4, Freddy Proaño-Pérez2, Martin J Zumárraga5, Jacobus H de Waard6,  
1 Instituto de Investigación en Salud Publica y Zoonosis-CIZ, Universidad Central del Ecuador, Quito, Ecuador; Programa de Doctorado, Facultad de Ciencias Veterinarias, Universidad de Buenos Aires, Buenos Aires, Argentina
2 Instituto de Investigación en Salud Publica y Zoonosis-CIZ; Facultad de Medicina Veterinaria, Universidad Central del Ecuador, Quito, Ecuador
3 Instituto de Investigación en Salud Publica y Zoonosis-CIZ; One Health Research Group, Facultad de Ciencias de la Salud, Universidad de Las Américas, Quito, Ecuador
4 Instituto de Investigación en Salud Publica y Zoonosis-CIZ, Universidad Central del Ecuador, Quito, Ecuador
5 Instituto de Agrobiotecnología y Biología Molecular, INTA-CONICET, Buenos Aires, Argentina
6 One Health Research Group, Facultad de Ciencias de la Salud, Universidad de Las Américas, Quito, Ecuador, Departamento de Tuberculosis, Instituto de Biomedicina Jacinto Convit, Universidad Central de Venezuela, Caracas, Venezuela

Correspondence Address:
Jacobus H de Waard
Departamento de Tuberculosis, Instituto de Biomedicina Jacinto Convit, Universidad Central de Venezuela, Caracas, Venezuela, One Health Research Group, Facultad de Ciencias de la Salud, Universidad de Las Américas, Quito

Abstract

Background: Mycobacterium avium subsp. paratuberculosis (MAP) is the causal agent of paratuberculosis, a chronic infectious contagious disease of the intestinal tract of ruminants that are also associated with Crohn's disease in humans. The existence of paratuberculosis in Ecuador is virtually unknown; hence, the present study was performed to gain insight into the prevalence of this disease. Methods: Three dairy cattle farms in different geographic regions in Ecuador were investigated for the infection with MAP, and 600 blood samples, 200 of each cattle herd, were processed with an indirect enzyme-linked immunosorbent assay. Fecal samples of the seropositive cows were processed for culture on modified Löwenstein–Jensen medium. Results: One hundred and fifty bovines (25%) resulted seropositive and we confirmed with culture the presence of MAP in 4.7% (7/150) of the seropositive cows. Approximately 20% of the fecal samples of seropositive cows yielded nontuberculous mycobacteria (NTM) species including M. avium subsp. avium, a NTM species closely related to MAP. Conclusions: The seroprevalence of paratuberculosis in this first study for Ecuador is high (25%). We discuss a possible interference of NTM species, isolated from fecal samples, with the diagnosis of paratuberculosis. With this report, a baseline study, we confirm for the first time the presence of paratuberculosis in Ecuador, and we provide the necessary information for future studies and control of this disease.



How to cite this article:
Echeverr G, Escobar H, Changoluisa D, Ron L, Proaño A, Proaño-Pérez F, Zumárraga MJ, de Waard JH. Prevalence of paratuberculosis in dairy cattle in ecuador.Int J Mycobacteriol 2020;9:1-6


How to cite this URL:
Echeverr G, Escobar H, Changoluisa D, Ron L, Proaño A, Proaño-Pérez F, Zumárraga MJ, de Waard JH. Prevalence of paratuberculosis in dairy cattle in ecuador. Int J Mycobacteriol [serial online] 2020 [cited 2020 Jun 5 ];9:1-6
Available from: http://www.ijmyco.org/text.asp?2020/9/1/1/280136


Full Text



 Introduction



Paratuberculosis or Johne's disease is a chronic infectious disease that primarily affects the small intestine tract of ruminants, produced by Mycobacterium avium subsp. paratuberculosis (MAP), responsible for considerable economic losses for the livestock (decreased milk production and slaughter value).[1] MAP affects domestic and wild ruminants, mainly sheep, goats, and cattle. The main symptomatology is the development of a granulomatous enteritis, weakening, diarrhea, and death due to cachexia.[2],[3],[4] It also has been suggested that paratuberculosis is a zoonotic disease, and there may be an association between Crohn's disease (CD) and Johne's disease,[5] and MAP has been cultured from the intestinal tissues and the blood of CD patients.[6]

MAP is a Gram-positive obligate intracellular pathogen that needs mycobactin (a siderophore used to shuttle free extracellular iron ions into the cytoplasm of mycobacterial cells) for “in vitro” growth, and therefore, is incapable to grow outside of its host.[7] Fecal cultures and specific antibody detection have been the most common diagnostic methods used for the diagnosis of the pathogen.[1] Enzyme-linked immunosorbent assay (ELISA) is recommended in dairy cattle with high prevalence (>5%) and pooled or individual fecal culture or polymerase chain reaction (PCR) for dairy cattle with low prevalence (<5%).[8] In a systematic review, published in 2017, regarding the prevalence of paratuberculosis in Latin America,[9] no prevalence data were reported for Ecuador, Cuba, Guatemala, Dominican Republic, Nicaragua, Honduras, El Salvador, Costa Rica, and Paraguay. Furthermore, in another more recent study, from 2019, for Ecuador, no confirmation of the presence of MAP in any specie had been reported, and no official paratuberculosis control program is in place in this country.[10] Sporadically, Ecuador has reported the presence of paratuberculosis in its territory in reports to the OIE-World Organization for Animal Health (Animal Health Information Database, 2013). However, there is no information of how the diagnosis was done, and MAP, as far as we know, has never been isolated in culture in the country. This may be due to the lack of knowledge concerning the disease by the livestock sector and/or the veterinarians in Ecuador, and also the absence of a specific control program, the limited availability of diagnostic tests (indirect ELISA [iELISA]), and the lack of culture facilities. The present study was realized to obtain information about the prevalence of paratuberculosis in three different regions of Ecuador using a commercial ELISA and confirm the presence of paratuberculosis in the country with the isolation of MAP in culture medium.

 Methods



Cattle herds

Three dairy cattle herds were sampled in the period between March and August 2018 in three different regions in three Ecuadorian provinces (Mejia, Patricia Pilar, and Victoria del Portete in Pichincha, Santo Domingo de los Tsachilas, and Azuay provinces) [Figure 1] for the location. Cattle herds with between 400 and 1200 heads were sampled and only cows between 2 and 8 years were considered for this study because paratuberculosis is characterized by a long incubation period (1.5–2 years) before cows become fecal culture positive for MAP.[11] No clinical cases of paratuberculosis were detected in the cows during the time of this study.{Figure 1}

Blood samples and indirect enzyme-linked immunosorbent assay

Six hundred blood serum samples were collected, 200 samples of each cattle herd from the tail vein of the cows, and tested with a commercial indirect immunoenzymatic assay (iELISA, ID Screen® Paratuberculosis, France) to determinate the serological status of the animals. The ELISA assay was performed according to the manufacturer instructions.

Culturing of Mycobacterium avium subsp.paratuberculosis

Culture medium

Stool samples of ELISA seropositive animals were cultured in Löwestein–Jensen media (LJ) and adapted for the growth of MAP by the addition of sodium pyruvate (0.5%) and mycobactin (2 mg/ml) (ID-VET, France). Two different cocktails of antibiotics were used in the medium to overcome growth of other microorganisms: (a) PANTA with a final concentration of polymyxin B (50,000 U/ml), amphotericin B (5 mg/mL), nalidixic acid (20 mg/mL), trimethoprim (5 mg/mL), and azlocillin (10 μg/mL) and (b) VAN: vancomycin (5 mg/mL), amphotericin B (5 mg/mL), and nalidixic acid (20 mg/mL).[12]

Fecal samples

Fecal samples were taken from the rectum introducing a hand with a long plastic glove in the rectum of the cow, in order to keep environmental contamination to a minimum. Samples were stored in the same glove turned inside out at 4°C until processing.

Isolation of Mycobacterium avium subsp.Paratuberculosis from fecal samples

Approximately 1 g of stool of each cow was placed in a 15 mL tube with conical bottom and homogenized by vortexing for 2 min with 6 mL of saline solution (0.9% NaCl). The tube was centrifuged for 5 min at 2000 rpm to remove the big particles and the supernatant, about 6 mL, was collected in a new tube of 15 mL. To decontaminate the samples, 6 mL of a 1.5% solution of hexadecylpyridinium chloride (HPC) (final concentration 0.75%) was added to this suspension, homogenized with a vortex, and incubated for 30 min at room temperature. The tube was then centrifuged for 30 min at 4000 g, and the pellet was washed with approximately 2 mL of sterile water. Finally, the tube was centrifuged for 30 min at 4000 g, and the pellet was reconstituted with approximately 0.5 mL of sterile water. One hundred microliters of the reconstituted pellet was inoculated in four culture tubes; two tubes of LJ medium + PANTA and in two tubes of LJ medium + VAN and incubated up to 14 weeks at 37°C until growth of colonies was visible.

Identification of Mycobacterium avium subsp.paratuberculosis

All colonies grown on the solid culture medium were tested with Ziehl–Neelsen (ZN) staining to confirm the presence of mycobacteria. For the isolation of DNA, several colonies of the acid-fast bacteria were resuspended in a 1.5 ml Eppendorf tube with 100 μL TE (Tris-EDTA) and boiled for 10 min at 100°C to liberate the DNA. Five microliters of this suspension was used for PCR to detect the presence of the IS900 fragment, which is highly specific for the MAP strains.[13] The primers used for the amplification were Fw CGATCGGAACGTCGGCTGGTCAGG and RevC GATCGCCTTGCTCATCGCTGCCG and the program: 3 min – 94°C; 30 cycles of 94°C – 1 min, 62°C – 1 min, 72°C – 1 min, and 72°C – 8 min.[14] A band of 218 bp, visualized in a 2% agarose gel, was considered positive for MAP. Mycobacteria negative for this IS900 PCR were identified with PCR restriction fragment analysis (PRA). The primers used for the PCR were Tb11 (5×-ACCAACGATGGTGTGTCCAT) and Tb12 (5×-CTTGTCGAACCGCATACCCT) and the program: 3 min – 94°C; 45 cycles of 94°C – 1 min, 62°C – 1 min, 72°C – 1 min, and 72°C – 10 min. For the BstE II and Hae III digestion, 10 μL of the PCR product was used for each digestion, and the digestion products were analyzed on a 3.5% agarose gel. The fragment lengths were determined with a 50 bp ladder as reference.[15]

Statistical analysis

All analyses were performed in R statistic project.[16] R Foundation for Statistical Computing, Vienna, Austria.

 Results



Of the 600 tested cows, 150 were classified as seropositive for paratuberculosis (25%). The seroprevalence per region differed significantly from 7% to 54.5% [Figure 1].

In 66 tubes of LJ-PANTA and 88 of LJ-VAN, visible growth of microorganisms was detected after 14 weeks of incubation. All culture tubes were readable, and no tubes had to be discarded for heavy contamination. With the ZN staining, we confirmed the presence of acid-fast bacilli in 30 cows: 14 cows yielded mycobacteria in both the medium, 5 only in LJ-PANTA medium, and 11 cows only in LJ-VAN medium. Although the yield of mycobacteria for both types of culture medium was not statistically significant, with the LJ-VAN medium, we isolated 45.5% more mycobacteria (n = 25) than with LJ PANTA (n = 19). Seven isolates, each from one individual cow, were identified as MAP with IS900 PCR and the PRA technique. Three MAP strains grew only in LJ-PANTA medium, two strains only in LJ-VAN medium, and two MAB strains were isolated from both the culture media [Table 1].{Table 1}

Although some contamination appeared in the culture tubes after 14 weeks of incubation, 1–20 colonies of other bacteria, all culture tubes were readable after 14 weeks of incubation. Twenty-five cows yielded nontuberculous mycobacteria (NTM) and three cows had two different species in their feces. These NTM were identified with PRA [Table 2]. Fecal samples of 11 cows only yielded NTM in LJ-VAN medium, 4 only in LJ-PANTA medium, and 10 in both the culture media. The kappa analysis,[17] comparing MAP and MNT isolation versus the PANTA or VAN antibiotic cocktail, showed moderate agreement (0.58% CI95%[39–76] and 0.43% CI95%[1.5–84]) with no statistic differences in the growth of other microorganisms (contamination), yield of mycobacteria, and isolation of MAP.{Table 2}

[Figure 1] shows the seroprevalence and the distribution of mycobacteria in general and MAP in the three sample areas. Significant difference in the seroprevalence of paratuberculosis (7%–54%) was found between the three geographic areas, with the highest seroprevalence in Machachi. In addition, significantly more NTM were isolated from fecal samples of a cattle herd from the Province of Santo Doming, a tropical area of Ecuador, but with the lowest paratuberculosis prevalence.

The NTM other than MAP were identified with the PRA technique, and the results can be found in [Table 2]. Mycobacterium nonchromogenicum was the most common species found in fecal samples. Three cows yielded M. avium subsp. avium. Twelve isolates, all with different PRA patterns, could not be identified because the PRA patterns were not present in the PRA-site database (http://app. chuv. ch/prasite/index.html).

 Discussion



This is the first report of the presence of MAP in Ecuador. The occurrence of MAP in dairy cattle in Ecuador was confirmed with culture and molecular identification. The presence of MAP in Latin American countries was reported for the first time about 100 years ago,[18] but the continent has a poor data collection record for paratuberculosis, and for most countries, there are no official prevalence rates and the majority of the countries do not have control programs.[10]

Prevalence in Ecuador

Three cattle herds from three different provinces in Ecuador were tested with the ID-Vet ELISA, and all three herds were infected with an overall seroprevalence of 25% with significant differences in seroprevalence for the three cattle herds. In comparison, it has been estimated that globally, in about half the countries, more than 20% of herds are infected and that the prevalence in a herd frequently exceeds 40%.[10] The ID-VET-ELISA was chosen for the diagnosis as it has demonstrated the highest overall accuracy of four commercial ELISA kits with a specificity of 99% and the diagnostic sensitivity of 31,6%.[19] Therefore, most of the seropositive cows tested in this study can be considered positive for paratuberculosis. Sensitivity of all available commercial ELISA tests is relatively low. The paratuberculosis iELISA has a preincubation step with Mycobacterium phlei antigens, a crude suspension of soluble antigens of a fast-growing, saprophytic Mycobacterium species that is widely distributed in soil and dust and on plants. This preincubation is used to remove all nonspecific antibodies in the serum and increase the specificity and test accuracy of the ELISA. However, this preincubation step compromises the sensitivity of the iELISA as also specific antibodies against MAP can cross-react in this preincubation step.[20] Considering this low sensitivity of the commercial iELISAs in our study, the real prevalence of paratuberculosis in our herds could be a factor 2 higher as we have determined.

Mycobacterium avium subsp. paratuberculosis culture

Before culturing of MAP, a chemical decontamination is applied to the fecal samples to eliminate all nontarget microorganisms. We used HPC as the decontaminant[21],[22] which is recommended because the HPC method decontamination method yields the highest percentage recovery of MAP.[23] Culture is considered the confirmatory test for the diagnosis of paratuberculosis, and the identification of ZN-positive culture isolates is usually done with an IS900-PCR, detection of DNA insertion element in the genome, and specific for MAP.[22] The testing of fecal samples of 150 seropositive cows by culture yielded only seven MAP strains, as confirmed with IS900 PCR. Our study shows the limitation for culturing as a conformational test of the presence of paratuberculosis in cattle herds as no clinical cases of paratuberculosis were detected during this study. The low yield of MAP in our study may be due to most cows in a subclinical stage, with a low quantity and intermittently excreting MAP in fecal matter.[24] Furthermore, our culture methods could have an impact on the isolation of MAP. Different protocols recommended for culturing of MAP have different analytical sensitivities,[25] and the yield of MAP depends on type of culture medium, incubation time, and the decontamination method. The major strains of MAP (types I, II, and III) have different needs for their growth. As stated in a reference,[26] an optimal solid culture medium for the isolation of MAP is modified Middlebrook 7H10 agar.[27] Another publication recommends LJ medium supplemented with pyruvate and mycobactin for isolating strains I and III, whereas for strains type II, it is the Herrold's egg yolk medium.[22] It also has been reported that pyruvate can be inhibitory to some isolates. Because the type of strain cannot be known in advance of culture, in this study, we only used supplemented LJ medium, but the recommendation for the future research is the use of the four solid media.[24] Concerning liquid culture medium for the isolation of MAP, this is considered the most sensitive antemortem test for the diagnosis in ruminants.[21],[25] However, this medium is not available in our laboratory and has a disadvantage: high contamination rates of the culture medium. Growth can be detected sooner using liquid culture techniques, but the identification of the organism is more difficult in liquid culture medium because colony morphology is not visible, and the growth of other organisms needs to be distinguished.[27] Concerning culture time, we cultivated only for 14 weeks, and the prolongation of the incubation period, especially for solid medium to more than 6 months increases the detection of MAP.[26]

Antibiotic cocktail VAN versus PANTA

To avoid contamination of culture media, a common occurrence in isolating MAP, the use of an antibiotic combination in the culture medium is recommended. The long incubation time of the culture tubes and the nature of the clinical samples, feces that are heavily contaminated with other bacteria, and molds make the cultures, despite a previous chemical decontamination step, prone to contamination and in general, about 5%–15% of the cultures cannot be read. In our study, all the culture tubes were readable, and no tubes had to be discarded for heavy contamination, although in about 33% of the tubes 1–20 colonies of other microorganisms were detected. However, the presence of antibiotics in the culture medium can have an inhibitory effect on the growth of mycobacteria.[25] We found no significant difference for MAP isolation with the two different antibiotic cocktails; however, the number of isolated MAP strains was low. In the media with the VAN cocktail, although statically not significant, about 32% more NTM were isolated. Apparently, some of the antibiotics in the PANTA cocktail inhibit the growth of NTM.

Nontuberculous mycobacteria other than Mycobacterium avium subsp. paratuberculosis

Regarding the NTM isolated in this study, this finding has also been reported in other studies with animals [Table 2]. The majority of the isolated NTMs are considered opportunism pathogens and have a low pathogenicity for humans but can cause diseases in the immunocompromised patient. Earlier reports have also mentioned the isolation of NTM from milk[28] and from lymph nodes[29] of otherwise healthy cattle. We cannot exclude that their presence in the intestinal tract, or in milk or lymph nodes, may evoke sensitization and triggers an immunological response in the animal causing false-positive results in the paratuberculosis iELISA. Three of our seropositive cows yielded M. avium ssp avium from the fecal samples, a species with 99% sequence homology with MAP.[30] The presence of NTMs in the cows' intestinal tract may also interfere with other diagnostic methods such as the tuberculin skin test and the interferon-γ test.[31]

 Conclusions



Here, we report for the first time the prevalence of paratuberculosis in dairy cattle in Ecuador, and we register a relative high prevalence. The isolation of MAP can be a challenge and different culture mediums are available, all with a specific diagnostic yield. The sensitivity of culturing of MAP for the confirmation of infection is limited. NTM were isolated from approximately 20% of the intestinal tracts of our cattle and a specific antibiotic combination in the culture medium (VAN) yielded a 32% higher number of NTM strains from fecal samples. Our report shows the need for the implementation of a control program, and a study to confirm the presence of clinical paratuberculosis in our country and the determination of risk factors. Furthermore, the prevalence of MAP infection in the sheep and goat population of Ecuador, an important life stock, needs attention.

Limitations of this study

No control group of fecal samples was investigated in this study to determine if seronegative cows also have MAP and/or NTM in their feces. The aim of this study was to isolate MAP and determine the prevalence of paratuberculosis in three cattle herds in Ecuador. The high prevalence of NTM in fecal samples came as a surprise. Twelve NTM could not be identified with PRA analysis and will be identified in the future with sequence analysis of the rpoB and 16S rRNA gene. This identification is not considered of importance for this manuscript.

Ethics approval and consent to participate

According to national regulations in Ecuador, the need for ethics approval is unnecessary for sample collection for the diagnosis of farm animals (“Ley Orgánica de Sanidad Agropecuaria” 2017, Asamblea Nacional, República del Ecuador). Written informed consent was obtained from the cattle owner who was informed of the results of this investigation. Blood drawing was done by veterinarians and free of cost to cattle owners.

Consent for publication

Written informed consent was obtained from the cattle owner who was informed of the results of this investigation and authorized publication of the data.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

References

1Lombard JE. Epidemiology and economics of paratuberculosis. Vet Clin North Am Food Anim Pract 2011;27:525-35.
2Doris O, Mayra C. Serologic diagnosis of bovine paratuberculosis with an iELISA in dairy cows from Mejia and registered in the Holstein Frisian Asosation of Ecuador. UCE Repos. 2012. p. 44. Available from: http://www.dspace.uce.edu.ec/handle/25000/347. [Last accessed on 2020 Feb 16].
3Dimareli-Malli Z, Mazaraki K, Stevenson K, Tsakos P, Zdragas A, Giantzi V, et al. Culture phenotypes and molecular characterization of Mycobacterium avium subsp. paratuberculosis isolates from small ruminants. Res Vet Sci 2013;95:49-53.
4de Waard JH. Milking mycobacteria from cattle? Health and economic impact of bovine tuberculosis and paratuberculosis in Colombia. Rev MVZ Córdoba 2010;15:2037-40. Available from: http://www.scielo.org.co/scielo.php?script=sci_arttext&pid=S0122-02682010000200001&lng=es&nrm=iso&tlng=es. [Last time assessed 2020 Feb 16].
5Kuenstner JT, Chamberlin W, Naser SA, Collins MT, Dow CT, Aitken JM, et al. Resolution of Crohn's disease and complex regional pain syndrome following treatment of paratuberculosis. World J Gastroenterol 2015;21:4048-62.
6Timms VJ, Daskalopoulos G, Mitchell HM, Neilan BA. The Association of Mycobacterium avium subsp. paratuberculosis with Inflammatory Bowel Disease. PLoS One 2016;11:e0148731.
7Lambrecht RS, Collins MT. Mycobacterium paratuberculosis. Factors that influence mycobactin dependence. Diagn Microbiol Infect Dis 1992;15:239-46.
8Fecteau ME. Paratuberculosis in cattle. Vet Clin North Am Food Anim Pract 2018;34:209-22.
9Espeschit IF, Schwarz DGG, Faria ACS, Souza MCC, Paolicchi FA, Juste RA, et al. Paratuberculosis in Latin America: A systematic review. Trop Anim Health Prod 2017;49:1557-76.
10Whittington R, Donat K, Weber MF, Kelton D, Nielsen SS, Eisenberg S, et al. Control of paratuberculosis: Who, why and how. A review of 48 countries. BMC Vet Res 2019;15:198.
11Espejo LA, Godden S, Hartmann WL, Wells SJ. Reduction in incidence of Johne's disease associated with implementation of a disease control program in Minnesota demonstration herds. J Dairy Sci 2012;95:4141-52.
12Chang CL, Park TS, Oh SH, Kim HH, Lee EY, Son HC, et al. Reduction of contamination of mycobacterial growth indicator tubes with a modified antimicrobial combination. J Clin Microbiol 2002;40:3845-7.2.
13Bhide M, Chakurkar E, Tkacikova L, Barbuddhe S, Novak M, Mikula I. IS900-PCR-based detection and characterization of Mycobacterium avium subsp. paratuberculosis from buffy coat of cattle and sheep. Vet Microbiol 2006;112:33-41.4.
14Collins DM, Stephens DM, de Lisle GW. Comparison of polymerase chain reaction tests and faecal culture for detecting Mycobacterium paratuberculosis in bovine faeces. Vet Microbiol 1993;36:289-99.
15Talaat AM, Reimschuessel R, Trucksis M. Identification of mycobacteria infecting fish to the species level using polymerase chain reaction and restriction enzyme analysis. Vet Microbiol 1997;58:229-37.
16R Foundation for Statistical Computing. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing; 2008.
17Thrusfield M, Christley R. Veterinary Epidemiology. Modern Fourth Edition. 4th ed. SBN: 978-1-118-28028-7. Wiley-Blackwell; 2018. p. 888.
18Mota PMPC, Pires PS, de Assis RA, Salvarani FM, Leite RMH, Dias LD, et al. Paratuberculosis in a dairy Gyr herd in the State of Paraíba, Brazil. Pesquisa Veterinária Brasileira, 2009;29:703-6. Available from: https://doi.org/10.1590/S0100-736X2009000900004.
19Fry MP, Kruze J, Collins MT. Evaluation of four commercial enzyme-linked immunosorbent assays for the diagnosis of bovine paratuberculosis in Chilean dairy herds. J Vet Diagn Invest 2008;20:329-32. Kennedy AE, Byrne N, Garcia AB, O'Mahony J, Sayers RG. Analysis of Johne's disease ELISA status and associated performance parameters in Irish dairy cows. BMC Vet Res. 2016;12:43. Doi: doi:10.1186/s12917-016-0667-y.
20McKenna SL, Keefe GP, Barkema HW, Sockett DC. Evaluation of three ELISAs for Mycobacterium avium subsp. paratuberculosis using tissue and fecal culture as comparison standards. Vet Microbiol 2005;110:105-11.
21Stabel JR. An improved method for cultivation of Mycobacterium paratuberculosis from bovine fecal samples and comparison to three other methods. J Vet Diagn Invest 1997;9:375-80.
22de Juan L, Alvarez J, Romero B, Bezos J, Castellanos E, Aranaz A, et al. Comparison of four different culture media for isolation and growth of type II and type I/III Mycobacterium avium subsp. paratuberculosis strains isolated from cattle and goats. Appl Environ Microbiol 2006;72:5927-32.
23Dundee L, Grant IR, Ball HJ, Rowe MT. Comparative evaluation of four decontamination protocols for the isolation of Mycobacterium avium subsp. paratuberculosis from milk. Lett Appl Microbiol 2001;33:173-7.
24Fernández-Silva JA, Abdulmawjood A, Bülte M. Diagnosis and Molecular Characterization of Mycobacterium avium subsp. paratuberculosis from Dairy Cows in Colombia. Vet Med Int 2011;2011:352561.
25Whittington RJ. Factors affecting isolation and identification of Mycobacterium avium subsp. paratuberculosis from fecal and tissue samples in a liquid culture system. J Clin Microbiol 2009;47:614-22.
26Whittington RJ, Marsh IB, Saunders V, Grant IR, Juste R, Sevilla IA, et al. Culture phenotypes of genomically and geographically diverse Mycobacterium avium subsp. paratuberculosis isolates from different hosts. J Clin Microbiol 2011;49:1822-30.
27Whittington RJ, Whittington AM, Waldron A, Begg DJ, de Silva K, Purdie AC, et al. Development and validation of a liquid medium (M7H9C) for routine culture of Mycobacterium avium subsp. paratuberculosis to replace modified Bactec 12B medium. J Clin Microbiol 2013;51:3993-4000.
28Franco MM, Paes AC, Ribeiro MG, de Figueiredo Pantoja JC, Santos AC, Miyata M, et al. Occurrence of mycobacteria in bovine milk samples from both individual and collective bulk tanks at farms and informal markets in the southeast region of Sao Paulo, Brazil. BMC Vet Res 2013;9:85.
29Ghielmetti G, Friedel U, Scherrer S, Sarno E, Landolt P, Dietz O, et al. Non-tuberculous Mycobacteria isolated from lymph nodes and faecal samples of healthy slaughtered cattle and the abattoir environment. Transbound Emerg Dis 2018;65:711-8.
30van Ingen J, Turenne CY, Tortoli E, Wallace RJ Jr., Brown-Elliott BA. A definition of the Mycobacterium avium complex for taxonomical and clinical purposes, a review. Int J Syst Evol Microbiol 2018;68:3666-77.
31Jenkins AO, Gormley E, Gcebe N, Fosgate GT, Conan A, Aagaard C, et al. Cross reactive immune responses in cattle arising from exposure to Mycobacterium bovis and non-tuberculous mycobacteria. Prev Vet Med 2018;152:16-22.