• Users Online: 68
  • Home
  • Print this page
  • Email this page

 Table of Contents  
Year : 2015  |  Volume : 4  |  Issue : 1  |  Page : 54-59

Comparative evaluation of PCR amplification of RLEP, 16S rRNA, rpoT and Sod A gene targets for detection of M. leprae DNA from clinical and environmental samples

Stanley Browne Laboratory, TLM Community Hospital, Nand Nagari, Delhi 110093, India

Date of Web Publication21-Feb-2017

Correspondence Address:
Utpal Sengupta
Stanley Browne Laboratory, TLM Community Hospital, Nand Nagari, Delhi 110093
Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.1016/j.ijmyco.2014.11.062

Rights and Permissions

Purpose: PCR assay is a highly sensitive, specific and reliable diagnostic tool for the identification of pathogens in many infectious diseases. Genome sequencing Mycobacterium leprae revealed several gene targets that could be used for the detection of DNA from clinical and environmental samples. The PCR sensitivity of particular gene targets for specific clinical and environmental isolates has not yet been established. The present study was conducted to compare the sensitivity of RLEP, rpoT, Sod A and 16S rRNA gene targets in the detection of M. leprae in slit skin smear (SSS), blood, soil samples of leprosy patients and their surroundings.
Method: Leprosy patients were classified into Paucibacillary (PB) and Multibacillary (MB) types. Ziehl–Neelsen (ZN) staining method for all the SSS samples and Bacteriological Index (BI) was calculated for all patients. Standard laboratory protocol was used for DNA extraction from SSS, blood and soil samples. PCR technique was performed for the detection of M. leprae DNA from all the above-mentioned samples.
Results: RLEP gene target was able to detect the presence of M. leprae in 83% of SSS, 100% of blood samples and in 36% of soil samples and was noted to be the best out of all other gene targets (rpoT, Sod A and 16S rRNA). It was noted that the RLEP gene target was able to detect the highest number (53%) of BI-negative leprosy patients amongst all the gene targets used in this study.
Conclusion: Amongst all the gene targets used in this study, PCR positivity using RLEP gene target was the highest in all the clinical and environmental samples. Further, the RLEP gene target was able to detect 53% of blood samples as positive in BI-negative leprosy cases indicating its future standardization and use for diagnostic purposes.

Keywords: M. leprae, Comparison of PCR positivity, Diagnostic of leprosy, Leprosy and different gene target, Clinical samples, Environmental samples

How to cite this article:
Turankar RP, Pandey S, Lavania M, Singh I, Nigam A, Darlong J, Darlong F, Sengupta U. Comparative evaluation of PCR amplification of RLEP, 16S rRNA, rpoT and Sod A gene targets for detection of M. leprae DNA from clinical and environmental samples. Int J Mycobacteriol 2015;4:54-9

How to cite this URL:
Turankar RP, Pandey S, Lavania M, Singh I, Nigam A, Darlong J, Darlong F, Sengupta U. Comparative evaluation of PCR amplification of RLEP, 16S rRNA, rpoT and Sod A gene targets for detection of M. leprae DNA from clinical and environmental samples. Int J Mycobacteriol [serial online] 2015 [cited 2021 Oct 21];4:54-9. Available from: https://www.ijmyco.org/text.asp?2015/4/1/54/200590

  Introduction Top

Leprosy is a chronic infectious disease of humans caused by Mycobacterium leprae and was discovered by G.A. Hansen in 1873. M. leprae is a non-cultivable mycobacteria, and diagnosis of the disease is based on its clinical, histopathological characteristics and finding the bacteria in skin scrapings and in biopsies taken from the patients. Due to its long incubation period and because very early lesions often do not satisfy the cardinal signs of leprosy, it becomes difficult to diagnose the disease in the early stages. Therefore, there is an urgent need to develop a tool for diagnosing the disease early so that the patient can be covered with chemotherapy under the control program. The diagnosis of leprosy is routinely based on clinical symptoms and finding acid-fast bacilli (AFB) in smears of skin scrapings. AFB staining technique requires the presence of at least 104 organisms per gram of tissue for its reliable detection under the microscope [1] and thus the organisms have a very low sensitivity of detection, especially in patients with intermediate lesions and at the Tuberculoid (TT)/Borderline Tuberculoid (BT) end of the disease spectrum where AFBs are rare or absent.

Several attempts have been made in the past to establish a test for the diagnosis of early leprosy; however, none of the tests were successful in diagnosing more than 60% of early cases of leprosy [2],[3],[4],[5] and, therefore, til today, there is no laboratory-based specific and sensitive assay for the detection of early leprosy.

Modern molecular methods like amplification by polymerase chain reaction (PCR) are more specific and sensitive for detecting bacillary DNA in clinical samples [6]. During the last 30 years, PCR methods have been developed to amplify different gene targets of M. leprae, but it is not known which target is most suitable for the diagnosis of leprosy. RLEP was found to be very sensitive and specific for M. leprae and detects 10fg of purified M. leprae DNA [7],[8]. 16S rRNA is a gene conserved in bacteria which codes for the 16S part of the ribosome [9],[10]. It has been used for RT-PCR targeting 16S rRNA for identification of viable bacilli from patients. Martinez et al. reported that with regard to 16S rRNA and RLEP, RT-PCR acts as a better target compared with superoxide dismutase (Sod A) and RLEP RT-PCR for viability testing of M. leprae [11].

Enormous numbers of leprosy bacilli are expelled into the environment from the nasal discharges of lepromatous patients [12]. There is also evidence to support the excretion of bacilli from skin lesions [13],[14]. A single mouth-wash of an LL patient may discharge 1.6 million M. leprae [15]. The risk of transmission of leprosy in the community, therefore, is subject to the availability of leprosy cases and other related environmental factors. There are evidences to support that M. leprae is able to survive for many days in the environment. Soil is known to be a medium which can preserve a variety of microorganisms [16]. Although PCR has already been applied for the detection of M. leprae for many years, it has been used mainly in samples from biopsies and SSS of leprosy and suspected cases and not in environmental samples.

The aim of the present study is to evaluate the usefulness of the PCR method on different clinical and environmental samples using different gene targets, such as RLEP, rpoT, sod A and 16S rRNA genes, and compare their efficiency in PCR positivity in clinical samples (blood and SSS) and environmental samples (soil) which were obtained from patients and from their surroundings.

  Materials and methods Top

Ethical approval

Informed consent was obtained from all the patients, and the study was approved by the Ethical Committee of The Leprosy Mission Trust India.

Recruitment of patients

Thirty newly diagnosed AFB negative PB and 30MB leprosy cases as per standard criteria of the World Health Organisation (WHO) were enrolled from the Outpatient Department of the TLM Hospital Shahdara, Delhi and Purulia, West Bengal. Grading of the bacterial load was determined by ZN staining of SSS. Fifty soil samples were collected in sterile plastic containers following a procedure described earlier [17] from residing areas and/or around the houses of leprosy patients staying in different villages of different blocks of the Purulia district of West Bengal ([Table 1]).
Table 1: SSS samples of PB and MB leprosy patients.

Click here to view

Sampling area

Different blocks of Purulia, West Bengal and Shahdara of Delhi were selected for sampling.

Slit skin smear sample collection

SSS samples were collected after taking four horizontal scrapes of tissue from an incision (5 mm long and 2 mm deep) made with the help of a sterile surgical scalpel blade (No. 15) on the left and right earlobes and skin lesions without any contamination with blood along the skin-slit part. The tissue material thus obtained on the blade by scraping was placed in 700 μl of 70% ethanol and mixed well in a micro-centrifuge tube. Later the SSS suspensions were kept at 4 °C for further use.

Collection of blood samples

Blood samples (2 ml each) were withdrawn from patients by antecubital venipuncture and collected in an EDTA vial; 300 μl of the blood sample was used for DNA extraction by using standard protocol as mentioned below (see [Table 2]).
Table 2: Blood samples of PB and MB leprosy patients.

Click here to view

Collection of soil sample

50 soil samples were collected in clean plastic containers (10g each) with the help of a hand trowel and labelled with a site code and the village name. Specific locations for the collection of soil samples were the bathing place, common sitting place, near the entrance of the house, areas around the house used for washing and a place near the bore well. Collected samples were transported to the laboratory at room temperature (within 2 days) and stored at 4–8 °C until further processing.

Extraction of DNA from slit sample

M. leprae DNA was isolated from SSS samples by Proteinase K lysis method [18]. Briefly, SSS samples were collected and kept in 70% ethanol. Then all the tubes were again centrifuged at 10,000×rpm for 10 min, and the supernatant was discarded. The pellet was dried in an incubator at 37 °C for 2 h; 200 μl of lysis buffer was added to the dried pellet. The pellets with lysis buffer were kept at 60 °C for overnight or 16 h in a shaking water bath for lysis. The lysis reaction was terminated by inactivating Proteinase K by incubation at 97 °C for 15 min. Lysates were stored at −20 °C until further use.

Extraction of DNA from blood sample

DNA was extracted and purified using a Master Pure DNA extraction Kit (Epicentre Technologies, USA) according to the manufacturer's instructions.

Extraction of DNA from soil sample by using kit

DNA was extracted and purified using a Power Soil DNA Isolation Kit (MO BIO-laboratories, USA) according to the manufacturer's instructions.

Polymerase chain reaction

DNA PCR amplification was carried out by using different gene targets of M. leprae. A total of 25 μl of reaction volume that contained 2 μl of template DNA, primers at a final concentration of 0.5μM (forward and reverse) and 1× Genei Mix (Merck India). M. leprae-specific RLEP primers sequences PS1 5’-TGC ATG TCA TGG CCT TGA GG-3’ and PS 2 5’-CAC CGA TAC CAG CGG CAG AA-3’ were used [7]. Amplification consisted of first stage of single cycle of denaturation at 95 °C for 5 min followed by second stage of 35–45 cycles of 30 s at 94 °C, 30 s at 58 °C and 1 min at 72 °C, and final stage of single cycle of 10 min at 72 °C. The M. leprae specific 16S rRNA primers (P2: 5’-TCG AAC GGA AAG GTC TCT AAA AAA TC-3’ and P3: 5’-CCT GCA CCG CAA AAA GCT TTC C-3’) described earlier were used [19]. PCR reaction without DNA was used as the negative control (reagent control). Purified M. leprae DNA was used as the positive control. The amplification was carried out in a thermal cycler (Corbett Research, Australia) under the following conditions of 95 °C for 5 min for initial denaturation followed by 37 cycles, each cycle consisting of denaturation at 95 °C for 30 s, primer annealing at 60 °C for 2 min and extension at 72 °C for 3 min followed by a final extension at 72 °C for 10 min. rpoT PCR amplification was carried out by using M. leprae DNA as per the protocol described earlier [20]. rpoT Primer A (VIC-5’-ATG CCGAACCGGACCTCGACGTTGA-3’) and B (5’-TCGTCTTCGAGGTCGTCGAGA-3’) (Gene Bank Accession No. AB019194) which were used for amplification span the 91bp (containing 3 repeats) or 97bp (containing 4 repeats) fragments of the rpoT gene target. The amplification was carried out in a thermal cycler (Corbett Research, Australia) under the conditions of 95 °C for 5 min for initial denaturation followed by 40 cycles, each cycle consisting of denaturation at 95 °C for 30 s, annealing at 60 °C for 2 min and extension at 72 °C for 3 min followed by a final extension at 72 °C for 10 min. The M. leprae specific Sod A primers (Sod A-F GGCCAGGTTCTTCTCGTTCA and Sod A-R CGCCGCATATGTCAAAGGTG) described earlier were used [21]. The amplification was carried out in a thermal cycler (Corbett Research, Australia) under the following conditions of 95 °C for 5 min for initial denaturation followed by 37 cycles, each cycle consisting of denaturation at 95 °C for 30 s, primer annealing at 60 °C for 90 s and extension at 72 °C for 60 s followed by a final extension at 72 °C for 10 min. PCR product containing an amplified fragment of the target region was electrophoresed in agarose (Sigma) gel using Tris–Borate–EDTA buffer at 100V constant voltage.

  Results Top

It is noted from [Table 3] that RLEP showed the highest (83%) positivity for M. leprae in SSS compared with rpoT (70%), Sod A (57%) and 16S rRNA (60%) gene targets, respectively ([Figure 1] and [Figure 2]). When PCR positivity for M. leprae in blood samples was compared, it was observed that all the BI positive cases were RLEP positive (100%), while the positivity for other targets were 80%, 90%, 43% for rpoT, Sod A and 16S rRNA, respectively ([Table 4]).
Table 3: PCR positivity from SSS samples.

Click here to view
Table 4: PCR positivity from blood samples by using different gene targets of M. leprae.

Click here to view
Figure 1: Shows PCR amplification of representative M. leprae gene targets of RLEP, 16S rRNA gene targets from SSS samples.

Click here to view
Figure 2: Shows PCR amplification of representative M. leprae gene targets of rpoT, Sod A gene targets from SSS samples.

Click here to view

It was interesting to note that RLEP showed the highest positivity of 30% of SSS and 53% of blood samples of BI negative PB cases amongst all the gene targets ([Table 5]).
Table 5: Comparison of BI negative SSS and blood samples with PCR assay by using different gene targets.

Click here to view

All 50 soil samples were screened by using the aforementioned M. leprae gene targets. It was observed that PCR positivity of M. leprae DNA from soil samples was the highest using the RLEP region (36%) as compared with 16S rRNA gene (30%), Sod A (0%), and rpoT (0%) ([Figure 3]).
Figure 3: PCR positivity of M. leprae DNA from soil samples by using different gene targets.

Click here to view

  Discussion Top

Although leprosy is one of the oldest infectious diseases that has inflicted man from biblical times, many questions on modes of entry, incubation period of the disease and early manifestation of the disease are still not known. Over the last few years, several articles have been published on PCR-mediated amplification of M. leprae DNA, and these data suggest that PCR could be a useful tool for the detection of infection with this pathogen. Identification of M. leprae is difficult from a biological sample due to its inability of the leprosy bacillus to grow in vitro. The diagnosis of leprosy is based on microscopic detection of AFB in tissue smears, in combination with histopathological and clinical evaluation. Because acid-fast staining requires at least the presence of 104 organisms per gram of tissue for reliable detection [22], sensitivity of detection is low, particularly for the majority of PB patients wherein AFB are rare or absent.

In the past 30 years, definitive identification of M. leprae has been possible through the development of methods for the amplification and identification of M. leprae DNA in clinical and environmental samples using PCR. The techniques have been applied not only to skin biopsy samples, but also to several different types of specimens, such as skin smears, nerves, urine, mouth washing, nasal swabs, blood, and ocular lesions [23],[24],[25],[26],[27],[28],[29],[30]. Different sequences were used as targets for PCR, such as genes encoding antigen 85 [26], 16S rDNA [21], RLEP [8] and sod A [21]. The M. leprae chromosome contains a family of dispersed repeats (RLEP) of variable structure and unknown function [31], and it was noted that the presence of the sequence of RLEP in M. leprae chromosome was repeated 28 times [21]. RLEP RT-PCR acts as a better target compared with Sod A for viability testing of M. leprae. It has demonstrated that the level of the Sod A gene transcript was reduced to only 5% compared with 16S rRNA gene, which was reduced to 38% within 48 h after rifampicin treatment. However, after a week of treatment, both were essentially at the background levels. rpoT gene, a homolog of the mycobacterial principle sigma factor, has been found recently to be present in three copies in most strains of M. leprae, including Tamil Nadu strain (TN), but in four copies in others [20],[32].

There are very few studies that focus on the detection of M. leprae from whole-blood samples. In the present study, the efficacy of PCR of several M. leprae gene targets in blood and SSS samples of AFB-negative PB and AFB-positive MB leprosy patients and soil samples collected from the surroundings of patients were investigated. RLEP PCR positivity from both blood and SSS samples was found to be the highest (100%, 83%) when compared with other gene targets of M. leprae. These results suggest that RLEP PCR could be used for the early detection of leprosy cases and for follow-up of the patients to assess bacterial load reduction during chemotherapy. Even though 83% of RLEP PCR positivity was observed from SSS samples of MB cases, all these cases were found to be positive in PCR from blood samples. Further, while in this study RLEP PCR was 100% positive, it was shown to be 53% positive in MB cases of leprosy [24]. In addition, the present study could also diagnose 53% of BI negative PB cases.

PCR positivity was highest among all the clinical and environmental samples by using the RLEP region of M. leprae. All these findings for the first time clearly demonstrated that the RLEP target is the most suitable out of all the other targets for identifying M. leprae gene either in the clinical samples or in the environmental samples. Future research may be directed using RLEP PCR in developing and standardizing an early diagnostic assay for leprosy.

  Declaration of interest Top

The authors declare that they have no conflict of interest.

  Acknowledgements Top

We acknowledge the infrastructural and financial support rendered by The Leprosy Mission Trust India (TLMTI) to carry out this research work at Stanley Browne Research Laboratory – The Leprosy Mission Community Hospital, Shahdara – New Delhi. We also acknowledge Dr. Sunil Anand, Director – TLMTI, Dr. Annamma John, Research Head Coordinator, TLMTI for their support and encouragement. We also wish to acknowledge support of the Superintendent and staff of TLM Hospital, Purulia. We would also like to extend our thanks to Mr. Atul Roy for assistance in sample collection.

  References Top

C.C. Shepard, D.H. McRae, A method for counting acid-fast bacteria, Int. J. Lepr. 36 (1968) 78–82.  Back to cited text no. 1
U. Sengupta, Mycobacterium leprae antigens and their utility in immunodiagnostics, Trop. Med. Parasitol. 41 (1990) 361–362.  Back to cited text no. 2
O. Parkash, V. Chaturvedi, B.K. Girdhar, U. Sengupta, A study on performance of two serological assays for diagnosis of leprosy patients, Lepr. Rev. 66 (1995) 26–30.  Back to cited text no. 3
S. Buhrer-Sekula, H.L. Smits, G.C. Gussenhoven, J. van Leeuwen, S. Amador, T. Fujiwara, et al, Simple and fast lateral flow test for classification of leprosy patients and identification of contacts with high risk developing leprosy, J. Clin. Microbiol. 41 (2003) 1991–1995.  Back to cited text no. 4
M.S. Duthie, W. Goto, G.C. Ireton, S.T. Reece, L.P.V. Cardoso, C.M.T. Martelli, et al, Use of protein antigens for early serological diagnosis of leprosy, Clin.Vaccine Immunol. 14 (2007) 1400–1408.  Back to cited text no. 5
M.Y.L. De Wit, W.R. Faber, S.R. Krieg, J.T. Douglas, S.B. Lucas, N. Montreewasuwat, et al, Application of a polymerase chain reaction for the detection of Mycobacterium leprae in skin tissues, J. Clin. Microbiol. 29 (1991) 906–910.  Back to cited text no. 6
H.D. Donoghue, J. Halto, M. Spigelman, PCR primer that can detect low levels of Mycobacterium leprae DNA, J. Med. Microbial. 50 (2001) 177–182.  Back to cited text no. 7
R.W. Truman, P.K. Andrews, N.Y. Robbins, L.B. Adams, J.L. Krahenbuhl, T.P. Gillis, Enumeration of Mycobacterium leprae using real-time PCR, PLoS Negl. Trop. Dis. 2 (2008) 328.  Back to cited text no. 8
M. Kurabachew, A. Wondimu, J.J. Ryon, Reverse transcription PCR detection of M. leprae in clinical specimens, J. Clin. Microbiol. 36 (1998) 1352–1356.  Back to cited text no. 9
S.R. Pattyn, D. Uris, M. Iven, R.J.W. Rees, P. James, Polymerase chain reaction amplifying DNA coding for species specific rRNA of Mycobacterium leprae, Int. J. Lepr. 60 (1992) 234–243.  Back to cited text no. 10
A.N. Martinez, C.F. Britto, J.A. Nery, Molecular determination of Mycobacterium leprae viability by use of real-time PCR, J. Clin. Microbiol. 47 (2009) 2124–2130.  Back to cited text no. 11
T.F. Davey, R.J. Rees, The nasal discharge in leprosy: clinical and bacteriological aspects, Lepr. Rev. 45 (1974) 121–134.  Back to cited text no. 12
C.K. Job, J. Jayakumar, M. Kearney, T.P. Gillis, Transmission of leprosy: a study of skin and nasal secretions of household contacts of leprosy patients using PCR, Am. J. Trop. Med. Hyg. 78 (2008) 518–521.  Back to cited text no. 13
G. Kotteswaran, C.J. Chacko, C.K. Job, Skin adnexa in leprosy their role in the dissemination of M. leprae, Lepr. India 52 (1980) 475–481.  Back to cited text no. 14
G. Ramu, Central JALMA Institute for Leprosy, Annual Report, Lepr. India 53 (1981) 307.  Back to cited text no. 15
K.V. Desikan, Sreevatsa, Extended studies on the viability of Mycobacterium leprae outside the human body, Lepr. Rev. 66 (1995) 287–295.  Back to cited text no. 16
R.P. Turankar, M. Lavania, M. Singh, et al, Dynamics of Mycobacterium leprae transmission in environmental context: deciphering the role of environment as a potential reservoir, Infect. Genet. Evol. 12 (2012) 121–126.  Back to cited text no. 17
R.S. Jadhav, M. Macdonald, G. Bjune, et al, MILEP2 study group, simplified PCR detection method for nasal Mycobacterium leprae, Int. J. Lepr. Other Mycobact. Dis. 69 (2001) 299–307.  Back to cited text no. 18
R.S. Jadhav, R.R. Kamble, V.S. Shinde, S. Edward, V.K. Edward, Use of reverse transcription polymerase chain reaction for the detection of Mycobacterium leprae in the slit-skin smears of leprosy patients, Indian J. Lepr. 77 (2005) 116–127.  Back to cited text no. 19
M. Matsuoka, S. Maeda, M. Kai, N. Nakata, G.T. Chae, T.P. Gillis, K. Kobayashi, et al, Mycobacterium leprae typing by genomic diversity and global distribution of genotypes, Int. J. Lepr. Other Mycobact. Dis. 68 (2000) 121–128.  Back to cited text no. 20
A.N. Martinez, R. Lahiri, T.L. Pittman, D. Scollard, R. Truman, et al, Molecular determination of Mycobacterium leprae viability by use of real-time PCR, J. Clin. Microbiol. 47 (2009) 2124–2130.  Back to cited text no. 21
C.C. Shepard, D.H.A. McRae, A method for counting acid-fast bacteria, Int. J. Lepr. 36 (1968) 78–82.   Back to cited text no. 22
M.R. Jardim, S.L. Antunes, A.R. Santos, O.J. Nascimento, J.A. Nery, et al, Criteria for diagnosis of pure neural leprosy, J. Neurol. 250 (2003) 806–809.  Back to cited text no. 23
A.R. Santos, A.B. De Miranda, E.N. Sarno, P.N. Suffys, W.M. Degrave, Use of PCR-mediated amplification of Mycobacterium leprae DNA in different types of clinical samples for the diagnosis of leprosy, J. Med. Microbiol. 39 (1993) 298–304.  Back to cited text no. 24
E.C. Almeida, A.N. Martinez, V.C. Maniero, A.M. Sales, N.C. Duppre, et al, Detection of Mycobacterium leprae DNA by polymerase chain reaction in the blood and nasal secretion of Brazilian household contacts, Mem. Inst. Oswaldo. Cruz 99 (2004) 509–511.  Back to cited text no. 25
A.N. Martinez, C.F. Britto, J.A. Nery, Evaluation of real-time and conventional PCR targeting complex 85 genes for detection of Mycobacterium leprae DNA in skin biopsy samples from patients diagnosed with leprosy, J. Clin. Microbiol. 44 (2006) 3154–3159.  Back to cited text no. 26
F.A. Shamsi, I.A. Chaudhry, M.O. Moraes, A.N. Martinez, F.C. Riley, Detection of Mycobacterium leprae in ocular tissues by histopathology and real time polymerase chain reaction, Ophthalmic Res. 39 (2007) 63–68.  Back to cited text no. 27
M.Y. de Wit, J.T. Douglas, J. McFadden, P.R. Klatser, Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens, J. Clin. Microbiol. 31 (1993) 502–506.  Back to cited text no. 28
K.R. Caleffi, R.D. Hirata, M.H. Hirat, E.R. Caleffi, V.L. Siqueira, et al, Use of the polymerase chain reaction to detect Mycobacterium leprae in urine, Braz. J. Med. Biol. Res. 45 (2012) 153–157.  Back to cited text no. 29
F.B. da Rosa, V.C. de Souza, T.A. de Almeida, V.A. do Nascimento, F.G. Vasquez, Detection of Mycobacterium leprae in saliva and the evaluation of oral sensitivity in patients with leprosy, Mem. Inst. Oswaldo Cruz 108 (2013) 572–577.  Back to cited text no. 30
S.A. Woods, S.T. Cole, A rapid method for the detection of potentially viable Mycobacterium leprae in human biopsies: a novel application of PCR, FEMS Microbiol. Lett. 53 (1989) 305– 309.  Back to cited text no. 31
M. Lavania, K. Katoch, H. Singh, R. Das, A.K. Gupta, R. Sharma, et al, Predominance of three copies of tandem repeats in rpoT gene of Mycobacterium leprae from Northern India, Infect. Genet. Evol. 7 (2007) 627–631.  Back to cited text no. 32


  [Figure 1], [Figure 2], [Figure 3]

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]

This article has been cited by
1 Detection of Mycobacterium leprae DNA in clinical and environmental samples using serological analysis and PCR
Ismênia Glauce de Oliveira Barreto da Silveira,Jorge Alves da Silva Neto,Jéssica da Silva Ferreira,Tatiane Severo Silva,Ioná Santos Araújo Holanda
Molecular Biology Reports. 2021;
[Pubmed] | [DOI]
2 Diagnostic utility of PCR in detection of clinical cases and carriers of leprosy: A cross sectional study at a tertiary care teaching hospital in central India
Shagufta Khatoon,Sanjay S. Negi,Namrata C. Chhabra,Anudita Bhargava,Padma Das,Priyanka Singh,Somya Sharma
Indian Journal of Medical Microbiology. 2021;
[Pubmed] | [DOI]
3 Latent leprosy infection identified by dual RLEP and anti-PGL-I positivity: Implications for new control strategies
Moises Batista da Silva,Wei Li,Raquel Carvalho Bouth,Angélica Rita Gobbo,Ana Caroline Cunha Messias,Tania Mara Pires Moraes,Erika Vanessa Oliveira Jorge,Josafá Gonçalves Barreto,Fred Bernardes Filho,Guilherme Augusto Barros Conde,Marco Andrey Cipriani Frade,Claudio Guedes Salgado,John Stewart Spencer,Supram Hosuru Subramanya
PLOS ONE. 2021; 16(5): e0251631
[Pubmed] | [DOI]
4 Development of a Loop-mediated isothermal amplification (LAMP) technique for specific and early detection of Mycobacterium leprae in clinical samples
Nupur Garg,Upasana Sahu,Sudeshna Kar,Farhan J. Ahmad
Scientific Reports. 2021; 11(1)
[Pubmed] | [DOI]
5 Development of a novel loop-mediated isothermal amplification assay for rapid detection of Mycobacterium leprae in clinical samples
Shweta Joshi,Vanila Sharma,V. Ramesh,Ruchi Singh,Poonam Salotra
Indian Journal of Dermatology, Venereology and Leprology. 2021; 0: 1
[Pubmed] | [DOI]
6 Identification of atypical dermal leishmaniasis resolved by restriction fragment length polymorphism
Srija Moulik,Ritika Sengupta,Aishwarya Dighal,Bikash Sardar,Bibhuti Saha,NilayKanti Das,Mitali Chatterjee
Indian Journal of Dermatology, Venereology and Leprology. 2020; 86(1): 45
[Pubmed] | [DOI]
7 Coamplification of Mycobacterium leprae genome sections by real-time PCR: Detection of the pathogen and the possibility of a semi-quantitative assessment of the bacterial load
D. A. Verbenko,A. E. Karamova,V. S. Solomka,A. A. Kubanov,D. G. Deryabin
Vestnik dermatologii i venerologii. 2020; 95(6): 22
[Pubmed] | [DOI]
8 Real-time PCR-based quantitation of viable Mycobacterium leprae strain from clinical samples and environmental sources and its genotype in multi-case leprosy families of India
Vikram Singh,Ravindra P. Turankar,Anjana Goel
European Journal of Clinical Microbiology & Infectious Diseases. 2020;
[Pubmed] | [DOI]
9 Ultra-sensitive detection of M. leprae: DNA extraction and PCR assays
Fernanda Saloum de Neves Manta,Thyago Leal-Calvo,Suelen Justo M. Moreira,Brunna L. C. Marques,Marcelo Ribeiro-Alves,Patrícia S. Rosa,José Augusto C. Nery,Rita de Cássia Pontello Rampazzo,Alexandre Dias Tavares Costa,Marco Aurelio Krieger,Milton Ozório Moraes,Husain Poonawala
PLOS Neglected Tropical Diseases. 2020; 14(5): e0008325
[Pubmed] | [DOI]
10 Development and evaluation of a droplet digital PCR assay for the diagnosis of paucibacillary leprosy in skin biopsy specimens
Xiujun Cheng,Lele Sun,Qing Zhao,Zihao Mi,Gongqi Yu,Zhenzhen Wang,Yonghu Sun,Chuan Wang,Chunhua Man,Fanghui Fu,Hong Liu,Furen Zhang,Abdallah M. Samy
PLOS Neglected Tropical Diseases. 2019; 13(3): e0007284
[Pubmed] | [DOI]
11 Detection of Mycobacterium leprae DNA in soil: multiple needles in the haystack
Maria Tió-Coma,Thomas Wijnands,Louise Pierneef,Anna Katarina Schilling,Korshed Alam,Johan Chandra Roy,William R. Faber,Henk Menke,Toine Pieters,Karen Stevenson,Jan Hendrik Richardus,Annemieke Geluk
Scientific Reports. 2019; 9(1)
[Pubmed] | [DOI]
12 A novel integrated molecular and serological analysis method to predict new cases of leprosy amongst household contacts
Rafael Silva Gama,Márcio Luís Moreira de Souza,Euzenir Nunes Sarno,Milton Ozório de Moraes,Aline Gonçalves,Mariane M. A. Stefani,Raúl Marcel González Garcia,Lucia Alves de Oliveira Fraga,Mathieu Picardeau
PLOS Neglected Tropical Diseases. 2019; 13(6): e0007400
[Pubmed] | [DOI]
13 Detection of Mycobacterium leprae using real-time PCR in paucibacillary leprosy patients with negative acid-fast bacilli smears
Arleen Devita,Fera Ibrahim,Sri Linuwih Susetyo Wardhani Menaldi,Angky Budianti,Andi Yasmon
Medical Journal of Indonesia. 2019; 28(4): 351
[Pubmed] | [DOI]
14 Molecular characterization of environmental mycobacterial species from leprosy endemic tribal regions of North Purulia District, West Bengal
Vikram Singh,RavindraPurushottam Turankar,Anjana Goel
International Journal of Mycobacteriology. 2019; 8(4): 381
[Pubmed] | [DOI]
15 Utility of multiplex PCR for early diagnosis and household contact surveillance for leprosy
Vinay Kumar Pathak,Itu Singh,Ravindra P Turankar,Mallika Lavania,Madhvi Ahuja,Vikram Singh,Utpal Sengupta
Diagnostic Microbiology and Infectious Disease. 2019;
[Pubmed] | [DOI]
16 Develop and Field Evolution of Single Tube Nested PCR, SYBRGreen PCR Methods, for the Diagnosis of Leprosy in Paraffin-embedded Formalin Fixed Tissues in Yunnan Province, a Hyper endemic Area of Leprosy in China
Xiaohua Chen,Yan Xing,Jun He,Fuyue Tan,Yuangang You,Yan Wen,Carlos Franco-Paredes
PLOS Neglected Tropical Diseases. 2019; 13(10): e0007731
[Pubmed] | [DOI]
17 Current updates on dental perspectives of leprosy – Revisited
Sushma Bommanavar,Jagadish Hosmani,Samar Khan,Shilpa Bhandi,Shankargouda Patil,Abdul Wahab H Alamir,Sachin Sarode,Kamran Habib Awan
Disease-a-Month. 2019; : 100918
[Pubmed] | [DOI]
18 Development of a combined RLEP/16S rRNA (RT) qPCR assay for the detection of viable M. leprae from nasal swab samples
Marcus Beissner,Anna Woestemeier,Malkin Saar,Kossi Badziklou,Issaka Maman,Charlotte Amedifou,Magdalena Wagner,Franz X. Wiedemann,Komi Amekuse,Basile Kobara,Karl-Heinz Herbinger,Abiba Banla Kere,Thomas Löscher,Gisela Bretzel
BMC Infectious Diseases. 2019; 19(1)
[Pubmed] | [DOI]
19 Association of non-tuberculous mycobacteria with Mycobacterium leprae in environment of leprosy endemic regions in India
Ravindra P. Turankar,Vikram Singh,Hariom Gupta,Vinay Kumar Pathak,Madhvi Ahuja,Itu Singh,Mallika Lavania,Amit Dinda,Utpal Sengupta
Infection, Genetics and Evolution. 2018;
[Pubmed] | [DOI]
20 High frequency of M. leprae DNA detection in asymptomatic household contacts
Rafael Silva Gama,Thalisson Artur Ribeiro Gomides,Chaiana Fróes Magalhães Gama,Suelen Justo Maria Moreira,Fernanda Saloum de Neves Manta,Lorena Bruna P. de Oliveira,Pedro Henrique Ferreira Marçal,Euzenir Nunes Sarno,Milton Ozório Moraes,Raúl Marcel González Garcia,Lucia Alves de Oliveira Fraga
BMC Infectious Diseases. 2018; 18(1)
[Pubmed] | [DOI]
21 Evaluation of 16S rRNA qPCR for detection of Mycobacterium leprae DNA in nasal secretion and skin biopsy samples from multibacillary and paucibacillary leprosy cases
Lívia Érika Carlos Marques,Cristiane Cunha Frota,Josiane da Silva Quetz,Alexandre Havt Bindá,Rosa Maria Salane Mota,Maria Araci de Andrade Pontes,Heitor de Sá Gonçalves,Carl Kendall,Ligia Regina Franco Sansigolo Kerr
Pathogens and Global Health. 2017; : 1
[Pubmed] | [DOI]
22 Leprosy in Children
Josafá Gonçalves Barreto,Marco Andrey Cipriani Frade,Fred Bernardes Filho,Moises Batista da Silva,John Stewart Spencer,Claudio Guedes Salgado
Current Infectious Disease Reports. 2017; 19(6)
[Pubmed] | [DOI]
23 qPCR detection of Mycobacterium leprae in biopsies and slit skin smear of different leprosy clinical forms
Michelle de Campos Soriani Azevedo,Natália Mortari Ramuno,Luciana Raquel Vincenzi Fachin,Mônica Tassa,Patrícia Sammarco Rosa,Andrea de Faria Fernandes Belone,Suzana Madeira Diório,Cleverson Teixeira Soares,Gustavo Pompermaier Garlet,Ana Paula Favaro Trombone
The Brazilian Journal of Infectious Diseases. 2017; 21(1): 71
[Pubmed] | [DOI]
24 Mycobacterium leprae specific genomic target in the promoter region of probable 4-alpha-glucanotransferase (ML1545) gene with potential sensitivity for polymerase chain reaction based diagnosis of leprosy
V. Sundeep Chaitanya,Madhusmita Das,Tiffany L. Eisenbach,Angela Amoako,Lakshmi Rajan,Ilse Horo,Mannam Ebenezer
International Journal of Mycobacteriology. 2016; 5(2): 135
[Pubmed] | [DOI]
25 Childhood Leprosy Revisited
Nerges Mistry,Sanjana Kuruwa,Shobha Pandya,Renu Minda,Vanaja Shetty
Pediatric Oncall. 2016; 13(4)
[Pubmed] | [DOI]


Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  In this article
Materials and me...
Declaration of i...
Article Figures
Article Tables

 Article Access Statistics
    PDF Downloaded251    
    Comments [Add]    
    Cited by others 25    

Recommend this journal